Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35115  (registered. 2012)
Contig Information
Length 1380 bp
Clones alternative view 32 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 2
Wh_V4816 Shoot grown under cold condition for 16days 1
WH_XN Leaves, plant was grown at constant 23 6
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
WH_XE Seedling, infected with leaf rust 6
WH_XF Seedling, infected with leaf rust 8
WH_XV Leaves, plant was grown at constant 23 4
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|108707824|gb|ABF95619.1|| 30S ribosomal protein S1, chloroplast precursor, putative, expressed"
Score 685
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35115
TTTTTTTTCTGCACGAAATGGATTGATGGCTTTACAAAAGGGGTACAACTTGAATTTCTTTTCCGCCGTTTTTCAGCACCTTACACTTCATACACAATGA
TACAAGCGCAAGTTGACGAGGGGAAATTATCTGAATATGATACGGTATTGTCTTCATCGTGCATTCACAAAAAGATGGACTACCGGGCATCTCTGGAATC
AGATGCATTCTTGCTATTGCACCTATTCGTCCGTAGGTAGGCCTTCCTCCTGTGCTGTGTCTGATGACAATGGACCTAAGATACCCTCTGAACTGAGAGA
CAGTCCACTCTCTGGCTGGAATCTTAACATGTCGGCACGAGCCATTGCCTCTGCTTGAGCTATTCTCTGCCTGAATATCTGCGCCATTTCATCAGCCTTT
TCGAAAACCAGCTTCGGGTTACGAATCATGTCACCAGGCGTTGGCTCAAGCTTCTTGGTAGAAAGGCTAACCCGGCCCCTTTCACGGTCATGGCTTAGTA
TCATAACCTTGAGGGTATCTCCTGGTTGAAGAACTGTCGAGATATCTGCGACACGGTCATGACTAATTTGGCTGACATGCAGAAGTCCATTGATTCCACC
GATATCGATAAAGGCACCATAAGGTTTTAGGCTTTCAACAGTTCCCAAAACAACTGAGCCAATACCAAGCTGGGCTTGGCTGTCGGCCATTGCCTTGCGA
TTACTGAGGACAAGCCTGCCTTGTTCCTCATCGACCTCCACAAACTTCAGAGGTAGTTCTTTGTCAAGCAGCTCTTCAGCAGTTGTTTTCGATGACACTT
GTGAAAATGGAACAAATGCCTTAAGGCCCTCCACAAGAGCCACCACACCTCCTTTGTTACCACCAATTACTTTACCCGTGATAACAACATCCTCTGCCTG
AAGCTGCCTGCATCTTTCCCAAGCAAGGTCTTGCTGAATTGATTGTAAGCTCAGAATCAAAGTTTCATCATTTGGGTTCTCATCAATTATCATGAACTGC
TCCACTAAACCCGGCCGGATGCCTGCCTCCTCTATATTGTCAATATCGAGAAGGCATGCCTCATCTATAGGCAAGAAAGCAGTAGCCTTTGATTGGATGT
CAATAAATGCACCATTTGAAGTGGTCATGAATACTGTCCCTTTAATGAGTGAGCCAATGTCAGTGTCGATGTCGGTGGTCTCGACGGCGGATTCGAGGTC
CTCGGGGGAGAAGGTGATGCCCTCCATGGGCGCAGTGCGGCAGCGCTCGGAGGCCTCGTCGAACAGCGTGCGCATCCGCTCCCGCTCCTTCTCGTCCTTG
CTCAGCACGTACGTCCCGCAGACCAGCGCGGACGGCCGCATAGGCGCCCCGGGGCGCCGCGACGCGCCGGAGAGCGGTGG
page-top