Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35089  (registered. 2012)
Contig Information
Length 904 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XE Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|162457928|ref|NP_001104984.1|| glutathione S-transferase GST 18 [Zea mays]
Score 337
Evalue 9.00E-91
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35089
GTGCTTCGTACTACCGTTTCCCCAGAGAAAACAATTGAGCGGAATTGGGATGCGGAAGGAGGAGGCAGCCATGTCGGCAGCAACGGGGAAGCCGATCCTG
TACAGCAAATGGTTCAGCTCCTGCTCGCACCGGGTTCGGATCGCCCTTAACCTCAAAGGTGTGGATTTCGAGTACAGAGCGACCAACCCGATGACAGATC
CAGATTATGAGAAAATCAATCCTGTTAAGTTTGTCCCAGCATTAGTGGATGGGGATTTTGTTGTTTCCGACTCGTTCGCAATCATTTTGTATATGGAAGA
CAAGTATCCTCAGTGTCCTCTCTTACCCCGAGATCTGAAAAAGAAAGCTCTTAATTTGCAGATTGCAAGCATAGTGTGTTCAAGCATCCAGCCTCTTCAG
AGCCATGCTGTCATTGGTTCATATCTTGGCACAATGGACACCAATGAGAGCCTTCAGATGGTTCAATATTATATTGACAAAGGCTTCAGAGCGATTGAGA
AACTTCTGGAAGGATGTGACAGCAAATATGCCACTGGAGATGAAGTTCAAATGGCGGATGTGTTTTTAGCGCCCCAGATCCACGCTGGTGTGACACGCTT
CCAAATCGATATGTCAAAGTACCCTATTTTGGCAAGGCTTCAAGACGCTTACAATGAGCATCCTGCATTTCAAGCCGCACTTCCTGCGAACCAACCAGAT
GCTCCTCCATCCCAGTAAAGTAATCAGGACCTCGATGACTGTAAGATTTTTCATGTTTGATCGAGATTCTATGATGTAATTTCAAAGTTAGATGCTCATG
TAAGCAAAGACCCCTGGATGAGCTTGACGACATTGCTGTAAAAGTGAATAAATGCAATTTATCGTATGTGCCAGTGTAAAATTCTAGTATCAATAAAAAA
AAAA
page-top