Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35085  (registered. 2012)
Contig Information
Length 805 bp
Clones alternative view 20 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_PCDAM Anther at meiosis 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 4
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115460164|ref|NP_001053682.1|| Os04g0586000 [Oryza sativa (japonica cultivar-group)]
Score 200
Evalue 1.00E-49
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35085
GCCTAGCTGAAAAGAAAGAGAAGCACTACCATTTCTACAGAAGAAACTACTCCATCGATCTCCATGGAAATCTACGGTGACCTCGAGGCCGGCTGCCTCA
GCCACTCCGTCTCTCCCATCAAGCCGGCGTCCCCGCCGAGGAAGGCCGGGCCGGGCCGCCTCTTCTGCGACCCCTGCGACGACGCCGGCGAGCTCCTCGG
CCACCACCACTACCTGGACATCTGCTTCAGCTGCCGGAAGCTCCTCGCCGGGAACAAAGACATCTTCATGTACAGAGGTGACACGCCCTTCTGTAGCGAG
GAGTGCAGGCAGGAGCAGATCGAGATCGACGAGGCGAGGGAGAAGCGGTCGAATCAGACCGGGAGGGCGGAGGAGCAGCGGCAGAGGCAGCAGCAGAAGC
AGAGCACCCCGAGGATCCCCGTCTGGGCGTGGTAGCAGCTTTCCGGCAACCAATCCGAACGTAGGATTTTCAGCAGCAGTTCGTGAACAAAAGCTCGATG
ATGGGTTGGGAAGCCTAGATCCAGTTGAGGGAAGCTTGGATCGCCGGTTCGACGGGACGACCACCACCTGCAGGCAGCAAACCTGCTGCATCTTTTATGC
TGTCTCTGAACCGCAGGGATGGGTTCTCACCCTTTTGATCTCCGAAGATGGAGACTAAGAGTTAAATTTTGTGTGTGAATTATCGCTGGTTTTTTGTTCT
TGTGTCGCGTAAGGTGTACCATAGCCTGCCTGTCGATATGAAAGAAAGTGAGAGGCATAACAAAAGCTCTCTCAGTTTTCAAATCAGTTCTGCTGTGTTC
TTGCC
page-top