Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35083  (registered. 2012)
Contig Information
Length 836 bp
Clones alternative view 142 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_KMP Shoot grown under continuous light 5
Wh_KMV Shoot grown with continuous light after cold treatment 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 48
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 23
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_XT Roots, 18 day old plants were grown hydroponically 9
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XE Seedling, infected with leaf rust 11
WH_XF Seedling, infected with leaf rust 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 9
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|228480395|gb|ACQ41880.1|| pathogenisis-related protein 1.1 [Triticum aestivum]
Score 345
Evalue 3.00E-93
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35083
CTCAATATCAGCTAGAGATTAAACTAACTGTAATGAAACTATGAAAGTTTTTTTTTTGTTTCAAGGTACCGTAAAAATGCACATTATTTATTATAGTCCA
TGATGGACAATACATGCTTGTTACGGCATTCCTTTTATTATAGCCCCTCTAGCTAGTTACAGTAGATAGGAACGTGCATGAATCCTTGCATGGGTGCTGC
CATGCAAGGAACGAGGGACTACTGGACTATATGTACTGCGAAGCAATCGCAGTTAGTATGGTTTCTGTCCAACAACATTCCCGGCGGGCTCGTAGTTGCA
GGTGATGAAGACGCCGCGGTTGTTGTTGCAGACGACGCGAGCGCAGCCGATGCTGGTCGACGCGCGCCACACCACCTGCGTGTAGTGCCCGCACACCTTC
CCCGACGCGCAGGTGTTGGACCCGTAGTTGTAGTCCTTCTTCTCGTCCACCCACAGCTTCACCGCGTCCGCCGCCTTCCAGTCCGCGCCGGCCGGCCCCC
AGAAGATGTTCTCCCCGTAGGGCCCGCCCGAGTGCTGGAGCTTGCAGTCGTTGATCCTCTGGTTGGCGTAGCTCTGGGCGAACCCCTGCAGCTTCGTGCT
CCAGCTCACCGCGCTCACGCCGACGGCGGCGCGGGCGGCGTTGTGAGGTGAGAGGTAGTCCTGAGGCGAGTTCTGGGCTTGGGAAAGGTTAACCATGGCG
GCCGCCATGGCTAGGGCGAGCAAAATGGCCAGCTTGGGCGTCTCCATTACTTCCTGGTTCGGTGTCTAAAAGGTTTCTACTATGTGCCTGCACTATAGCT
AGCTGCGTATGTGTAGGCCGTAGCTAGCTAGCTTTG
page-top