Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35067  (registered. 2012)
Contig Information
Length 1871 bp
Clones alternative view 162 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 1
Wh_r Root 1
Wh_SH - 5
Wh_DPA20 Seed DPA20 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 3
Wh_V483 Shoot grown under cold condition for 3days 7
Wh_VABA Shoot with ABA treatment 11
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 16
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 5
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 13
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23Ž 6
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 10
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 9
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 1
WH_XB Root 6
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 8
WH_XF Seedling, infected with leaf rust 11
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23Ž 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115589736|gb|ABJ15727.1|| serine hydroxymethyltransferase [Triticum monococcum]
Score 1009
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35067
ACGAGGAGGCCGCCCACCACCACCACCACCACCACCCACCATGGCCATGGCGACGGCGCTCCGCAAGCTCTCCGCCCGCGGCCAGCCCCTCTCCCGCCTC
ACGCCGCTCTACTCCATGGCGTCTCTGCCGGCGACGGAGGAGAGATCCGCAGTCACCTGGCCCAAGCAGTTGAACGCGCCGCTGGAGGAGGTCGACCCCG
AGATTGCCGACATCATCGAGCTCGAGAAGGCCCGCCAATGGAAGGGGCTGGAGCTCATCCCGTCGGAGAACTTCACCTCCCTCTCGGTGATGCAGGCGGT
GGGATCCGTCATGACCAACAAGTACAGCGAGGGGTACCCCGGCGCGAGATACTACGGTGGAAACGAATACATTGATATGGCCGAGACGCTGTGCCAGAAA
CGTGCTTTGGAGGCTTTCAATTTGGACCCAGAGAAGTGGGGAGTGAATGTGCAACCTCTATCGGGTTCACCTGCCAACTTCCATGTATACACTGCTCTGC
TGAAGCCACATGATAGAATTATGGCTCTGGATCTTCCTCACGGTGGACATCTTTCCCATGGTTACCAGACTGACACAAAGAAAATCTCAGCAGTTTCAAT
ATTCTTTGAGACAATGCCTTACAGACTGGATGAAAGCACTGGCTTGATTGATTATGACCAGTTGGAGAAAAGTGCCGTTCTTTTTAGGCCAAAGTTGATT
GTTGCTGGTGCTAGTGCATATGCCCGCCTTTATGATTATAACCGCATGCGGAAGATCTGTGACAAGCAGAAGGCAGTTCTTCTCGCAGACATGGCACATA
TCAGTGGGCTAGTTGCTGCTGGTGTCATTCCGTCTCCTTTTGAGTATGCAGATGTGGTGACTACCACTACCCACAAGTCTCTCCGTGGTCCACGTGGAGC
CATGATCTTTTTCCGGAAGGGGGTGAAAGAAATAAACAAACAAGGGAAGGAGGTTAAGTATGATTTTGAGGACAAAATCAATGCTGCTGTCTTCCCAGGT
CTGCAAGGTGGACCCCATAACCATACTATTACTGGCCTGGCCGTTGCGCTTAAGCAGGCAACTACTCAGGAGTACAGAGCTTATCAAGAGCAAGTTATGA
GTAACTCTGCTAGATTTGCTGAGAGCTTGACTTCAAAAGGTTACGACATTGTCTCTGGTGGGACTGATAACCATTTAGTTTTGGTGAACCTCAAGAAAAA
GGGAATAGATGGTTCACGTGTGGAGAAGGTTTTAGAAAATGTGCATATTGCAGCAAACAAGAACACGGTTCCTGGTGATGTTTCAGCTATGGTACCCGGA
GGCATCAGGATGGGAACCCCCGCACTTACATCAAGAGGATTTGTTGAGGAGGACTTCGCCAAGGTTGCTGACTTCTTCGATTCGGCAGTGAACTTGGCCT
TGAAGGTTAAAGCTGCAGCAGCAGGTACCAAACTGAAGGACTTTGTTGCCACATTGCAATCCGACAGCAACATCCAAGCTGAAATTGCAAAGCTTCGCCA
CGATGTGGAGGAATATGCGAAACAATTCCCAACAATTGGATTCGAGAAGGAGACCATGAAGTACAAGAACTAAGAACTGCTATGTTTCAACAGCAAGGAA
GCAAACAAGAAGCACAGTTTGAGGACAAGTCATGTAAACAATAGATCCACGATGAAGCGCCACCTTATGTAAAAGGAATCCAATCATTTTACAGAATATG
GGAACTTTGTCGATAGTTTCTTATTGCAGGCACATACTGTAAGATGCTTCGCTGATATGCTATATGAACCGCCATCCTTCTTGGATAAACATTTACTTAC
ACGCATTTCTCCATGTGCTCTGGGGATAACACGTATGATTCGGCTTTGAGATCTTGAGCGGTTCGTGAGTT
page-top