Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35053  (registered. 2012)
Contig Information
Length 1178 bp
Clones alternative view 120 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 7
Wh_V4816 Shoot grown under cold condition for 16days 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 7
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 47
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 8
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 7
WH_XT Roots, 18 day old plants were grown hydroponically 6
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_SP 1
WH_XE Seedling, infected with leaf rust 6
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 8
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|135917|sp|P27357.1|TLP_WHEAT|TLP_WHEAT RecName: Full=Thaumatin-like protein PWIR2; Flags: Precursor
Score 369
Evalue 5.00E-100
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35053
CGGCACCAGCGGGCGGAATGACTGAATAAAGGTTTCGTACATGGCATTTTGTTCAGTTAAATGCCAGCACTCTTCCACTCTGGCACGCAGTGCTGCACGA
GAAAGCGCCAGTGGTATTTGCGCTTCAAAACAAATCACGTTATCCGCCACCCCCGCTTCATGCAAAAGTGTCTGTACATCCGCCAGTTTTTGCGACGGCG
ATGCCATCAGGCTGGGTGCCAGTGCGCCAAAACCTTGCCAGATCAACTGCTTTTTGACATCAGCCAGGCAAAGCTCGAGCATAGCAACAGCACTAAAGCT
AACTAGAGCTTCCAGCAATGGCGACCTCCCCGGTGCTCTTCCTCCTCCTCGCTGTTTTCGCCGCCGGTGCCAGCGCGGCCACCTTCAACATCAAGAACAA
CTGTGGCTTCACAATTTGGCCGGCGGGCATCCCGGTGGGTGGGGGCTTCGCGCTGGGCTCAGGGCAGACGTCCAGCATCAACGTGCCCGCGGGCACCCAA
GCCGGGAGGATATGGGCCCGCACCGGGTGCTCCTTCAATGGCGGTAGCGGGAGCTGCCAGACCGGCGACTGCGGCGGCCAGCTATCCTGCTCCCTCTCCG
GGCGGCCACCAGCAACGCTGGCCGAGTACACCATCGGCGGCGGCAGCACCCAGGACTTCTACGACATCTCGGTGATCGACGGCTTCAACCTTGCCATGGA
CTTCTCGTGCAGCACCGGCGACGCGCTCCAGTGCAGGGACCCCAGCTGCCCGCCGCCGCAAGCCTACCAACACCCCAACGACGTCGCCACACACGCCTGC
AGTGGCAATAATAACTACCAGATCACCTTCTGTCCATGAAGCCTCTATACGTCGCACCGCGAATCAATAAAAGGCGTACGTAGATATACGGCCATATAAA
TAAAAGGTGTACTGCTTAATACATCACATTGTCATATTACAGCCGCCGTACTACATGTTAGCCCACTACTATGAGCGTTTCATTGATATTTGTGTACACA
GTACAGGGCAATAAAAAAATTACCTATCTACCTTAAAAAAAAAAGCACCCTGACGCAACATGGTCAGCTATTAGTATTACTTGCTCACGCCGATGTCACG
ACATTGACATCGGCGTGCCAAAGGAGCCACCACATGTGCGTGGATAGCACATGGGGCCCTACGCGGCCATCATGTGTA
page-top