Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35  (registered. 2012)
Contig Information
Length 1846 bp
Clones alternative view 14 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_CSEC Callus 2
Wh_PCDAM Anther at meiosis 2
Wh_VSCB Liquid cultured tissue 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218197711|gb|EEC80138.1|| hypothetical protein OsI_21929 [Oryza sativa Indica Group]
Score 865
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35
AATGTCAATCAGGAGGAGTTAGATGATATTATCCGGTATGGGTCAAAAGAACTTTTTGATGATGACGAGGATGAAGCTGGAAAGTCACGCCAAATACATT
ATGACGATGCTGCAATAGATAGGTTATTGGACCGTGACCAAGTCGACGAGGAAGAATATTTGGAAGATGAAGAAGATGACGAATTTCTGAAAGGTTTCAA
GGTTGCGAACTTCGAGTACATAGATGAAGCTAAAGCTTTAGCAGCAAAAGAGGAGGCACGCAAAAAAGCGGAAGCTGAAGCCGCATCCAATAAAGCAAAC
TATTGGGAAGAATTATTGAAAGACAGATGCATTGAGCAAGAAGTAGAAGAAATTGCTATGGGAAAAGGAAAAAGAAGCCGCAAGCAGATGGCTGCTGCTG
ATGAGGATGACATTACTGGCCTGCACGAGTTAAGTTCTGAAGACGAGGATTACTCCTATGATGATGATGTGTCGGATAATGACACGAGTTTACCAGCAAA
TGTTTCTGGGAGGAAGGCTCAGTATTCTAAGAAAAACTCACGTAATGTAGATTCACTCCCTTTGATGGAGGGTGAAGGGCGTGCTTTAAAAGTTTATGGA
TTCAATCACGTTCAACGAACACAATTCCTACAGACACTCATGAGGTATGGTTTTCAGAACTATGATTGGAAAGAGTATCTTCCTCGTTTGAAGGGGAAAA
GTGTTGAGGAAATTCAGAGATATGGTGAGCTTGTCATGGCCCATCTTGTAGAGGACACAAATGACTCACCAACCTATGCAGATGGTGTGCCGAAGGAAAT
GCGTGCTGATGAGACATTGGTCAGGCTAGCCAAAATATCACTTGTGGAGGAGAAGGTGGCTGCCATGGAGCAAGGAAAAATTACAAAACTCTTCCCCAAC
TACTTGATGTATGAATTTACTGGCTTATCAGGTGGAAGAATATGGAAAGGGGAACATGATCTACTGTTACTGAAAGCATTAATAAAGCACGGGTATGCCA
GGTGGCAATACATATCAGATGACAGAGATAACGGGCTATTTGAAACTGCTCGACGGGAGCTTAATCTTCCTTCTGCTAATGAATTGATTAGTTCTCAGTC
AAACAATGAGGCAAATGGAAATCTGGAAAGCACACAGGAAGTGCAGGTGAACCCAACGAGCTTATCTCAATACAGGGACATCCAGAGAAAGATTGTTGAG
TTTATCAGAAAGAGATACCATATTCTGGAAAAATGCTTGGACATTGAATATGCCGTGATAAAAACAAATACTCCTGTTCCTGATGATCTTACTGAACAAA
ATGTTCCTATGGGACATAGCCCAGCTGTTCCAGATATCAGTGAAGTGTTGAGAGAACTTCCCCCTCTTGTACCAATTTCTGCCAAAGAAGTGGCTTCTGA
TGGCTCAACTGACCAGGCACACCTTTCCCATCTTTACAACAAGATGTGCGGTGTGCTTGAGGACAGTGGCCCACGTGCACTCAATTCGTTCTGTGGTGAC
AAGGCAGCCTCTGCGAGTCTAGCCAACAGCCTCCATCAGTTTGAGAAAGTATGCGAGGACGTTGATCGGGTCTTGAGAGTCCAAGAGAACGGTGCTGCTA
CCCCCAAAGAACAAGTGGTAGATGCCAGCGTCGAAGAGGCCAAGGCTCCACAAGTGCCTTCACAAGATGCAGGCGTTGTGGCGGCGAACGTTGTCGGGCC
TTCGACGGTAAAGCCGGAGGACAAAATGGAAATCGATGGTTGATGTTTAGGGATAAGAACTGTATCGGACCCCCTCTTCAGTTTAGTTGCTAAACTGGTT
CTAGTCTACCAGTAGTCAGTACTAATGATTACCTATACCAAATTTT
page-top