Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34964  (registered. 2012)
Contig Information
Length 1374 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 6
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_SP 1
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226528152|ref|NP_001150317.1|| calnexin [Zea mays]
Score 728
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34964
ATCCTTTCAGTTTCGTTTGATACAAAAGGAAAAGAAGATCACTTCTAGCTGATTCCGTACAGCACACAAACAACACAAAGCTTCACCGGCTCGTAGATTC
TAGCGACTTAAAAACTAGGGGTAGCAGCAGAGGGCAGCAAGACTGTTCGATTATACACTCGAGGAGTTCACAAAAAGGCGAGGACCGAGACCGTCCGAAA
TGTGAAGATCCTACGTCTCCCTTCGCGACCTTCTGCGTGGTGCGGTTGTGTCATCCTCCTTCTCGTTGTCGCCGCTGCTTCCAGCGGCATCGGCTTCCGT
GGCACTGGGCTTCTTGACCTCGGCAATGGGCTTCACAGGTGCCACTGGCTTCTTGCCACCGAAAAGGGTTCTGAAGAGTACAGTCACAAGGATGACAGCG
GCTGAGGCCAAGATCGAAATTGTAATGTTGGGCTGCTTCTCTCCCTTCTCAATAACATCAATGATCTTGATCTTGTAAGGTTCCAAGAATGGAATGTCGG
CGATCTTGTACAAAACGCTGAAGATCTTCTTCTGGAACTCAGAAAGGTCCTCTGAATCGGCTGCTGCAGCCTCCTCAGCCTTCTGCTTTTCCTTCTCAAC
ATCAAACTTGGGCTTCCATGTCTTCTCCAAGATGGCGGTGGCTACCTTCTCATCATCGGCGATAAGAATGTTGTCAAAAAGGATGCCATCCTGCATTGTC
CAGATCTCAATTCCAATAGCGGCAATCGGATCAAAGTCAGGCTTGTCAAGCTCAAAGTATTCAGGGTTGGGGATTTCTTGGGGCTTCCAGATTCCCTTGT
AGGCAGGGTTGTCAATCATGGGTGCATGCCACTTGCCCTTGTACGCAGGGTTCTGCTTCATTGGCCTCTTCCATTCACCACATCCAGGTGCCTCTTCACA
CTTGGGGTTGTCAATCTTCGGTGCCTCCCATTCACCATCCTCCTCATCATCCCAGTCTTCGGGCTTAGCAGCCTCTGGGTCATCAACTTCCTCAGGCTCA
TCATCCAACCATCCTTCTGGCTTGGTGGCCTCCTCATCCAGAATTTCTGTTGGGGCATCCTCATCCCAGTCATCGGGCTTCACTGCAGCTGGGTCAGGGA
TTTTAGCTCTCTCGTCCCAGTCCTCTGGCTTCTTGTCGTCAGGGTCAGGAATAGTCTTTGATGGAATAAGTGCTGGCTCAAAATCATCAGCGGACAGGAA
GTTTGCTTTGCTCTTCTCCTCCCCGTCAACCAAAATTCTGACCTCGTTATCCGGCTTCAAGATAGCCGTATAGACATGAGAGAGCTTGTCATATGGGACA
GAGGGTGGGGACTTAAGGTGATGTTCAACATATTTGCCAGTCTTGGGGTTCTTGTGCTTCAGGATGAAGTGAAC
page-top