Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3496  (registered. 2012)
Contig Information
Length 821 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 3
Wh_OKCS Seed DPA5 1
Wh_VSCB Liquid cultured tissue 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125525387|gb|EAY73501.1|| hypothetical protein OsI_01383 [Oryza sativa Indica Group]
Score 303
Evalue 2.00E-80
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3496
GACGCTGTGCATAACTGATAAGTTACAAACAGAAGGCTTGGTCTCTTTCAGATGACCTAGATAAACAATTTGAGGAAACGTCCGTCAAAGGAACTAAAAG
AAAAAGATACCCAGTTGCAGCTACTAAAATCAGGATGATGTGAAAATTTCAACCATTCGACCACTTTGCTCAAAATTTTCCCTAGCCAGACTAACGCTGC
TTTGGCGGCTACACTCACAGCTCCAGGCTTTTCTATCTATCCACCTCGGTAGCCGTTCTTTCTTATGGTTATGGTTGTAATAGTGGAGTCATTGTTTCCT
CGTGACAGTTTAGAGCTCGTCGTGGCCGGACAGGTCTGAAGACGCAGCGTCGAGTTTCTGTTGCAGCTCCTTCAGCTTCTCTTCAACACACATTGCAGGA
GTTGACAGTACAGCGACATACTCGCATCTGCTGGGCTCATCGACACCGTTAAGCTCGTTGCTCAGCCCACATCTAAGCCTGACCTTTAGGCTTCGGTCAG
GGCCATTCCAGCATTTGTCTCCATTTGAAAAGTGCATCATCCTGCAGGATTCTTCAAATTTGTCCCAGCGCCCCAGGTTAGTGGAACTGTGTCCTTCAAC
CTGTGAAGCTTTCTTGTATGGACAGACCTTGTAAACATACTTGCCCTCCTTGCCCTCAAAGCACTGGTCATAAAAGTAATAAAACTCCTTCTCCTTACCA
AAGTCTTGCTTTAGCTTATCTGTCAGAGAGGTTATCCTAGATTGAATTTTGGACAGCTTTGAGCTAGCATCATCATACTCCTTCCGAACATGAGCAGCCT
CTGATAAATCAACAGGGGTCC
page-top