Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3495  (registered. 2012)
Contig Information
Length 1074 bp
Clones alternative view 20 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Wh_r Root 1
Wh_VSCB Liquid cultured tissue 5
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_SP 1
WH_XB Root 5
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242036039|ref|XP_002465414.1|| hypothetical protein SORBIDRAFT_01g038360 [Sorghum bicolor]
Score 532
Evalue 2.00E-149
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3495
TACATTGGCAAGCACATTTTGAAAGAAAAAGGCACACACACACAAATAGCTGGGGCAAGCTAAAAATATCTCATGATCTTCTTAGCATTGGCAGGATAGA
ACACAGGCGATGGCCACAGCTCACAAGTACAGTAACTAGTAGGCACAAAACTAAGAACATAACAGAAGAGCAAAGATAAACTGTTCAACATTATTTGATG
GCAACGTGCTGCTGGATGCGACTACTAGTGATGCAGGCGTGCTTGGTCTACTGGGGGTTGGGTGGCCTGGAGTTGGCAGCAGAGACCCTGGAGCCCCATT
CCAGAAGCTCTTTGCTGGTGTCGTCCTTGTGCGCGATCACCTCGATGAAGCACAGAGAGTCCTTCTTCTCCCCCAGCGCCGTCTCTATCGCCGCCGTCAG
CTCCTCCTCGCACTTCACCTTGGCAGTCCAGCATTTGCCCTCCCCGTTGTGGATGGCCTCCACAAGGGCGGTGTAGTTCCAGTTCTTGATGACATTGTAA
GGCCCGTCGTGGATCTCCACCTCGATCGTGTACCCGCCATTGTTGATCAGGAAGATTATGCTGTTCTGTTCGCACCGCAGCATAGTTGACACATCCTGTG
CTGTCACCTGGAAGCTCCCATCACCAATGCAGGCTATGACACGCTTGTCACTCGCCCCTTGCGCGTACCCGAGCAATGCACCCACTGACCATCCAATCGA
GCCATACTGCATTTGGAATTCATACCCGCAGCCCTCGGGCAGCTTGAGCTTCTGGCAGTTGAACCAGGAGTCACCGGTCTCAGCGAGCACTGCACTATCA
CCCGTCAGCATGTCCTGGATGTGCTTGAAGAGCACATTGACACGCAGCGGCTCGTTCGCCTCGCCCTTCAGCGGATGGCCCTCAGGCACGAAGATCCTCT
TGTAGTTCTCGTAGGCGGTGGTGTTCTTCTGAACCCGCTTGGCCAATGCAGACAGGTACTCCTTCATCATGACGCAGCCGAATGCCGGGCCGTTCCCGAC
GATGACACGCTCAGGCTGCACGATGATGGCCTTGTCCTTCTTGAGCAGGAACGAGTAGCCAACAGAGCTGTAGT
page-top