Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3492  (registered. 2012)
Contig Information
Length 805 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XB Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115459800|ref|NP_001053500.1|| Os04g0551800 [Oryza sativa (japonica cultivar-group)]
Score 329
Evalue 2.00E-88
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3492
TGCCCTAAGGCTACAGACAAAATTTCTTTCCATTCGCAAGTCGTTCTGCTACCCCACATACAGCGAAACACACAGCAATACACCTTCATGCATCGATCTT
CCATACAACATTCTACAAGAACGTATGCTAACATAAGTTGGAAAAAGAAAACCACAACCAGCAATCTAAGAGCCTATAGCAACCAGCCATCGCGTAACAA
ACAGCAAACGCCCATCATAAAATGGCATATGGCTACTCTTCTTGGCCAGACTCTTCCTTGTCGAGCTTGATCATGTCGTCGATCCTCACAATGGTAATGG
CTGCTTCTGTGGCAAACTGAATGATCTTCACTTTGCTCATTGCTGGCTCGATCACGCCATGTTCAAGGTTGTTGCGGATTACACCTTTCGTCAGGTCAAG
ACCCATGCTTGATAAGTGCTGCTTATCAGCATTGGTTTGAGCTTTATTATGATATGCCCTAAGTTGTGCAACAAGGTCAGTTGCATCTTTTGCGGCATTA
ACAGCGAGGACCTTCGGTATGATCAACAAAGCTTCTGCAAATTCAGCAATCGCCAGCTGTTCCCTGGATCCAAGAGTTGTAGCAAGATTCTCCAGGTACA
CAGATAATGCGGCTTCTACAGCACCACCGCCAGCAACTACCGTATTGGATTCCAAAGTTCTCTTCACAATGCACAGTGCATCATGCAAAGACCGTTCAAT
CTCATCTAGCATGAAATCATTTGCTCCTCTAAGTATAATGGAGACCGCACTTGTATTCTTTGTGCCTTTCACCAGAATTATTTCATCATCAGAAATCCTT
TCCTC
page-top