Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34891  (registered. 2012)
Contig Information
Length 558 bp
Clones alternative view 29 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
Wh_SH - 1
Wh_V4816 Shoot grown under cold condition for 16days 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 3
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XA Root 2
WH_XB Root 5
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|124295114|gb|ABN04099.1|| Rpr4901.2 [Hordeum vulgare subsp. vulgare]
Score 164
Evalue 6.00E-39
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34891
ACAATTGAACAAATCAACATCATTTTCATTTCACATGGACGGGTGGCAATTTGGTCGAGTTTACGTCTGTCGGCATTACACGAATGAATACGCAGGAATC
AAATGCTAGAGAAAGCAAGAAAAACAGAGCAGAGCTTCCAAAGATGAAGAGAACTCGCACAGTTCCAATACAGAATTGAGACTCATGGACCCGATTCCAC
TTCAAATCCTCCCGTGGTCACGCGCACGGCGCACGGTGGCTGGGCTTGTCGGTCTAGCTGGTGGCTCCACCGCCGGCGAGGCATGGACAGAATTTGGCCA
AGAAGCCCGGTTTAGCCGCCGGCGCTGCCGTGTTCTGCTCGTGGTTTGACGGGCGGCCGACGAAGTAATCGCCAGGAGTATTCAGCGCAGCTGGAGCAGG
CTCAGGGACGGCCTGCGGCGGTTCTTTCTCCTTGGGCTCGTCGGTGTTCGCTGGACGGCCGATGAAGTAGCCTCCAGGAGGAGCATTGCCCTGGCCGTCG
CTCATGGCGGATGGACAGTTCTCCGGCTGGGATGAGCTGCTTCCTCTCTCTCTCTCTC
page-top