Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34867  (registered. 2012)
Contig Information
Length 1212 bp
Clones alternative view 25 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 1
WH_XR Roots, 18 day old plants were grown hydroponically 6
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XT Roots, 18 day old plants were grown hydroponically 8
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|61657664|emb|CAI64809.1|| putative glucan endo-1,3-beta-D-glucosidase [Triticum aestivum]"
Score 617
Evalue 7.00E-175
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34867
CAGAGACCCAGCTGAAACCTTGATCCCGTAGCTAGCCATGACGATCGGCGTCTGCTACGGCGTGGTCGCCAACAACCTCCCGCCGGCCAACGAGGTGGTG
CAGCTCTACAGGTCCAAGGGCCTCACCGGCATGCGCATCTACTTCGCCGACGCCAAGGCCCTCTCCGCGCTCCGCGGCTCCGGCATCGGCCTCATCCTCG
ACGTCGGCGGCACCGACGTGCTGGCCAGCCTCGCCGCCAACGCCTCCAACGCCGCGAACTGGGTCCGGGATAACGTCAGGCCCTACTATCCGGCGGTGAA
CATCAAGTACATCGCCGCCGGCAACGAGGTCCTGGGCGGCGACACGCAGAACATCGTCCCGGCCATACGGAACCTCAACGCGGCCCTCGCCGGCGCCGGC
CTCGGCGCCATCAAGGTGTCCACCTCGATCCGGTTCGACGCGGTGACCAACACCTTCCCGCCCTCCAACGGCGTGTTCGCGCAGGCCTACATGACGGACG
TGGCCCGGCTCCTGGCGAGCACCGGCGCGCCGCTGCTGGCCAACGTGTACCCCTACTTCGCCTACAAGGACAACCCGCGGGACATCCAGCTGAACTACGC
GACGTTCCGGCCGGGCACCACGGTGCGCGACCAGAACAACGGGCTGACCTACACGTGCCTGTTCGACGCCATGGTGGACGCCCTGGTGGCGGCGCTGGAG
CGGGCCGGCGCGCCGGGGGTGAGGGTGGTGGTTTCGGAGAGCGGGTGGCCGTCGGCGAGCGGGTTCGCGGCGACGGCGGACAACGCGAGGGCGTACAACC
AGGGGCTGATCGACCACGTCGGCGGGGGCACGCCCAAGAGGCCCGGCGCGCTGGAGACGTACATCTTCGCCATGTTCAACGAGAACTTCAAGACCGGGCA
GCTCACCGAGAAGCACTTCGGGCTGTTCAACCCGGACAAGTCGCCGGCGTACCCTATCCAGTTCCGTTAGTCTGGCTGCGTCGTCCATACATGCGCCCGT
ATGTACACACGTGCACTGTCAACCTAAATAAGCTGCGTATAGTGCAGGAGTGAAGTGTAACGTGGATACAATATACGTACACGTCGACATATTGTCAGCC
TAAATAAGCTGCACGTATATTGCAGCAGTGAAGTGTAACGAGAATGCATGTCATAACATCGATTCATGCAAGAGTAGTGCAATGCAACCATTCCAGGTGG
TGTTATATATCG
page-top