Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34858  (registered. 2012)
Contig Information
Length 990 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 4
WH_XV Leaves, plant was grown at constant 23℃ 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115454873|ref|NP_001051037.1|| Os03g0708500 [Oryza sativa (japonica cultivar-group)]
Score 411
Evalue 7.00E-113
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34858
TTTTTTTTTTGTTTTTTTTGTGAAGCTTGCATGAGTTCATATTCATCAGGATTCAGATTACAGCAAGAAGGAATAGCTTCTTAAGCTCTGAGAGAATTTT
GACATGGCAACAGAATCTGCACGAAGTGTTGTCCAACGCAAACTGAAACAGCATATGTTGATCATCTATCTACTGACGTCCGGCACACCGGAGCGGAGGG
CCTCACGCCGGCGCGATGGACACCTTGTCGACCTGCACGACGTACTCCAGGGTCGCCCCGGGGGGCACCTGCGCGCCGTCGTCCCCGAAGTCGGCGCCGT
CCTCGCCGAAGCCGAGGCTCGCCGGTACGACCACGCGCCGCTTGCCGCCGTTCCGCATGGACCGCAGCGCGTACTCGATGCCCTCGCACATGCCCCTGGT
GTAGGGCCTGGAGCCCATGACGAGCGCCAGCGGCCGCTTCCCGTCGCCGAACGTGTCCACGAACGCCTCGCCGCCGCCGGCCACCCGCCCCTGCAGGTCG
ATCACCACCAGGTCGCCCGGCCGCGGCACGTCGCCGCCGCCCACCCGCATCTCCGTGTACCGGATTCCATTGGGCAGGACGACCTCCTTCTCCTCCTCCA
CGTCCTTGGTGTTGGCCTGCTGCTGCGCGACCTCGAAGCGGGTCTTGAGCTGCTCCGACACGACGCCGAAGGCCAGGAACCCGACCCACGCCAGCCCGGC
GCCGATGCCGAACCGCCGCGTCAGCGACGACGCGACCCAGTCCGTCGAGTCGGCCGACGTCGCCGCGCGCTTCGGCGCCGGCGCCCTCGCCGGTGCCGCC
TGCGCCTGCATGGGCTCTTGCTGCTGTGGCGGCGGTGGGGGCTGGTCGGACGGCGGCTGGGCGCTGGGCGGGCGCGAGGGCGGCGCGCACGAGACGTGCG
GCTTGGCGGCGGGGCGGGCGAGGAAGGCCGGGGAGCTGCCCAAGAAAGTGGCCATGGCGGGCACCGGCACGATTCGTACGGTGTGGAGAG
page-top