Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34805  (registered. 2012)
Contig Information
Length 829 bp
Clones alternative view 58 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 4
Wh_r Root 2
Wh_EM Dormant seed with water absorption 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 4
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 7
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_SP 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 8
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|133907544|gb|ABO42268.1|| ubiquitin-like protein 5 [Hordeum vulgare]
Score 152
Evalue 3.00E-35
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34805
TTTTTGATGTAACAGTGTAATACTGCCATTATCACAACCCCAGGTAAGACAGTTTATGTTATTTATAAACTTCACAGTAACAGCACATTAGATTCGCAGG
TCGATCACAGGAAAAGTATGTTCAGGCTGTCAATAATCATCATGGGTACAATAATGCACTACTTATATAGTAGCTCGCTGAAGTTCAGCCCACACATTGA
GCTCTGAAGACACTGGGACTGGAATGCAACCAAAGCTATCATCGCAGGCAACAATAGGTGACCAACCTGCAATGGCCGGAGGCTAGTTGTAGTAGAGCTC
GAGGCCCATGCCGTCGTGGATCTCGTAGTCGCCGAGGGTGATGTGGTCCTTGTAGATGGTGTACCACTTCTGGATGCGGATCTTCTCGGCCCTGGTCCCG
GTCTGCGCCGCCACGAGCTTCTTGAGGTCGCCGATGGTGTCGTCCTCGTTGCACTTGACGCGCACCTTCTTCCCCAGGCGGTCGTTGAGCACCACCTCGA
TCATCTTCGCTCCCGCTCGCGTCGATTGATCGATCGATCGACCAAACCCTAGCCCCGGCGAGAGCTGCAGCGGCCTTGTGCTTTTCGATTGAGAATTGGG
GGTGGTGGTATAATAGAGATAGATAGATAGATAACAAAGTACTAGCAGCACCTCGAGCATTCGGTGTAAAGAACACACAAATCTGGATCAAACTTGTTTC
ACCCAACAGATATCTTGATGCCTATGTATGTGTATCTCAAACACCCAGAAGCACTAGATACCAAGTATCGCNNNNNNNCAACCACGCACAGCTGCTTACT
TGCCACCACCGATTTCCTTCACAGCGCAG
page-top