Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34778  (registered. 2012)
Contig Information
Length 1793 bp
Clones alternative view 62 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 2
Wh_SH - 2
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_KMP Shoot grown under continuous light 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_VHS Shoot with heat shock treatment 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 5
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 5
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 5
WH_XE Seedling, infected with leaf rust 6
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|146760215|emb|CAM58983.1|| beta tubulin 5 [Hordeum vulgare subsp. vulgare]
Score 916
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34778
CCTCCCCCGCACCACCACCACCGGACCACCGTCACCGGCGGCGAAGGCACGATGAGGGAGATCCTGCACATACAGGGCGGGCAGTGCGGGAACCAGATCG
GGGCCAAGTTCTGGGAGGTGATCTGCGACGAGCACGGGATCGACGGGACGGGGCGCTACGCGGGGGACTCGGACCTGCAGCTGGAGCGGATCAACGTCTA
CTACAACGAGGCGAGCGGGGGCCGGTTCGTGCCCCGCGCCGTGCTCATGGACCTCGAGCCGGGGACCATGGACTCGGTGCGCTCCGGCCCCTTCGGCCAG
ATCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCCGGCGCCGGCAACAACTGGGCCAAGGGACACTACACCGAGGGCGCCGAGCTCATCGATTCCGTCC
TCGACGTCGTCCGCAAGGAGGCCGAGAACTGCGACTGCCTCCAGGGATTCCAAGTTTGCCATTCCTTGGGAGGAGGCACTGGATCTGGGATGGGCACCCT
TCTTATTTCTAAGATTAGGGAGGAGTACCCTGACCGAATGATGCTGACATTCTCTGTCTTCCCATCACCAAAGGTCTCCGACACCGTTGTTGAGCCATAC
AATGCTACACTTTCTGTTCACCAACTTGTTGAGAACGCTGATGAGTGTATGGTGCTTGACAATGAAGCTCTATACGACATATGCTTCCGCACACTAAAGC
TTGCCACCCCTTCCTTTGGTGACCTGAACCATCTTATCTCTGCTACCATGAGCGGTGTCACATGCTGCCTGAGGTTCCCTGGACAACTCAACTCCGATCT
TCGCAAGCTTGCTGTGAATCTCATCCCATTCCCCCGCCTCCACTTCTTCATGGTTGGCTTCGCACCACTGACGTCGCGTGGGTCACAAATGTACCGTGCT
CTCACAGTCCCTGAGCTGACCCAGCAAATGTGGGATGCCAAGAACATGATGTGCGCCGCAGACCCCCGCCATGGCCGCTACCTCACCGCCTCGGCCTGCT
TCCGAGGGAAGATGAGCACCAAGGAGGTGGACGAGCAGATGCTCAACGTCCAGAACAAGAACTCGTCGTACTTTGTGGAGTGGATCCCCAACAACGTCAA
GTCGAGCGTGTGCGACATGCCGCCCAGGGGGCTGAAGATGGCGGGCACCTTCGTCGGCAACTCCACGTCCATCCAGGAGATGTTCCGCAGGGTGAGCGAG
CAGTTCACGGCCATGTTCAGGAGGAAGGCCTTCCTGCACTGGTACACGGGCGAGGGCATGGACGAGATGGAGTTCACCGAGGCCGAGAGCAACATGAACG
ACCTCGTCGCCGAGTACCAGCAGTACCAGGACGCGACCGCCGACGAGGAGTACGACGAGGAGGAGGAAGAGGAACGCGACGCGGAGTAGTGGCGCCGTGC
CCTGCTCCACCCCAGCTATATGTCCCCCGGTTCAGGTCTGTCGCCATGTCCAGGTCGCGTTTCCTCCGGTGAGGGTTTGTGTGGTTTCCTCCTGTGGCTT
GGATGAGTCGAGGTTGCGTCTTGTGCTCCGTTTTGTAATTTGCTACGGCTAGTAGTGCGTTGCAGTCTGTCGTGTTCAGCATCATTTGGTCAGTCGGTCC
ATAGCTGACGATGGCCTGAACTGTCGAGTGCTCTCCTTGAGCTAGTCGTCGCCTTGTAAGTTCTGACAAGTATTATTGTTAGTCGTTCGCTTCAGCAACC
AAAAAATGAGTATTGGTAGTGGTTTCTCATTATCTTTGTGAATATTGTACTTATGTCGGAATGTTTTTGCCTTGTTATTTGTGTATATTTCGT
page-top