Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34729  (registered. 2012)
Contig Information
Length 772 bp
Clones alternative view 40 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 1
Wh_h Spike at heading date 2
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 6
WH_SP 4
WH_XA Root 2
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 7
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|15281775|gb|AAK94425.1|AF398144_1|AF398144_1 60S ribosomal protein L144 [Brassica rapa subsp. pekinensis]
Score 222
Evalue 4.00E-56
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34729
TTTTTTTTTTACTTGATCACTCCAATGTCATTATGCTAAGCACTTCACAACAACATATTCAGCAATAAAATCACATTCAAAGCTAAAACCTAAACATTAC
TTTTGAAACAGAGAGAATACACAATCAAAGTGTAAAACCAGAAACATATACAGTCCTAATGGGACCAGTTACAAACATAACGAACTCAAAAGCAGAAAGA
ACATTTTTACTTGTCTCAAGGATCTGAAGAGAGTCGTTGACAGGAAAGGCAAAACATATGCTCCATAGCCCATACAGTTATACCCAGAATACCAATATGA
TACTAATACATTGTTCGAGTGGGAAGTTCTGGCACAACACTGAACAAAACAGGGATATCATCAGCTTAGAAGAGAGAGGTCCCCTTGCCCTTCTTGTCTC
CACCGATCTCAAAGTGCTTGCACCTCTTGATAGCGCGTTGCGAGTAATGCTTGCAGCTCTGGCACTGCAGCTTCAGCACAATCTTCTTTGTTGTCTTGGC
CTTCTTGTGGAAAACAGGCTTTGTCTGGCCACCATATCCTGACTGCTTGCGGTCGTAACGGCGCTTTCCCTGAGCAGAAAGACTGTCCTTGCCTTTCTTG
TACTGCGTAACCTTGTGGAGGGTGTGCTTCTTGCACTCCTTGTTCTTGCAGTAGGTCTTCTTGGTCTTTGGAACGTTCACCATGGTCGCCGCCTGGAAGC
TCTCCTCCGCGCGTCTGCTTCTTCTCCTGCGGCGTGGGCGGCGGTGAGGAAAGGGGGAAGGGGGCCTCGTGC
page-top