Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3472  (registered. 2012)
Contig Information
Length 638 bp
Clones alternative view 28 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 3
Wh_r Root 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 3
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XC Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig3472
GTGTTTCTTTTTGGAAGAAACACTATCAACTTCCACAGGCTTTNNTCCAAAAAGAAACACTAGCTACAGGATGTGCATTTTTTTTTTGGGAACAGTTTTT
TGTGCCCTCGTATGTTTATCTGAGTAGTGAGTAGCAGAGGAGTACACTATCAACTGAACAACCGGAACTCCATGTCGAAGAAGGAAATATAAGCATAAAT
GTTAAGGCAATTTACAGGGGGATACACTAAGCGTCGCATGCTCTGTCAATGTTCCACAAATTTACCGGACTGCGACAACCAGAAAAAACTGACAAGACAA
TACAACAACAGCAGCAAAATCAACTACGTTCCTGGGGCTTTAGTTCCCCACGACGCCTTCTGCTGCTCCTGCTGCTGCCGCAACGGCCGCTCCTTTGCTC
TGCCAGTACTGATAGGCATAGTAAACGGAGGACACTGCTAGGGCGCCGAGGACGATGTAGGTGATGATCCTCACCAGGCCGATCTGAGTAGGGCCCTTCT
TCTGCTTGCTCTGTGCCAGCAATGCCTTTGGCTTGATCTTCGCCATTGTTCAGCTCTTAGGCTCGCGGCGGAGATGGGCCGGAGGAGGAGGACGGGGTTG
GTCGCCGGGGGAATGGGGGAGGAGCGCGCGCCTCGTGC
page-top