Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34706  (registered. 2012)
Contig Information
Length 1349 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_SHC Shoot grown with cold treatment 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_SP 1
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242086967|ref|XP_002439316.1|| hypothetical protein SORBIDRAFT_09g004260 [Sorghum bicolor]
Score 620
Evalue 1.00E-175
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34706
CAACATCCACAGGCAAAAATGTACCACAAAAGTAACTTACAAAAACAGATGCCGCGCAACCAGGAAGAACAACCAGAATAGGTGGTGCTGTTAAATCCGG
CCTAATTCTGTACAGAGAAAACGAGTGCAGAGCCAATGGACATTTACAAATGCTCGGCAACTAAGGGTGGTTAAGCAAGACAATTGGCTGGTGGATGAAT
ATTGCCATGCCCTGGTGGATCCAAACAATAGATCAGATCACCCCCTTCGAGCCGACGATGCTAATATTGAAGGAATGGATGTTGATCAGATCAGGCACTT
CCCCCGGTTGCTGGCTTATTTGGAATTTGTCTTTTTACCCGCGATGTGCCTGTTTCATTTGGCTTCAAGATTTGAAATGAGCACATTAGATTTTCATCTA
TGCTCAACAGAGCACCTACATTATCGAATTCCCCGCAGTAATTTGGAGCTGAGAAGATGGTGACTAATCTCCGCTGTGCGAAGAACTCATAACCATCTTC
TACCACCTGATGGGCTCGGCAGATAAGATCAAGATCATTTTTCTCCAAGAACTCTATAAGCATATCTGCACCAAACGTACATGAAACACCTCTGTCACTC
TCCCCCCACCCTTCTCCGTCAGGGCTAGGATCAGACCAAAGCAAATCACACAGGAGACCATAATCAGGAATCTCAGCCGGCCTCTCAATATCCTTTATTT
GGTCCAGGTTAGTCAGTTCAGGTGAAAGGCCACCATGCATGCACAGTATCTTGTCGTCAATGAGTGCTGCAATAGGCAGGCAGTTGAAGCAATCAGAGAA
TATCTTCCACAGTCGAACATTGAACCTCCTCTTGCATTCATCATAGAAACCATAAACTCTGTTGATTTTGGCATCTTCATGGTTACCCCTTAACAGGAAA
ACCTTGTCAGGGTACCTTATTTTGTACGCCAGCAGTAAGCATATAGTTTCCAAGCTCTGTTTGCCTCTATCTACGTAGTCTCCAAGGAATACATAGGTTG
AGGTTGGAGGATAACCACCCAAATCAAACAACCTCAGAAGATCAACAAACTGACCATGGATATCACCGCAGATCTTGACGGGGGCCTGGATGCGGAGGAG
GTTCGGCTGGGACAGGAAAACCCGCTTGGCGTCGACGCAGAGCTGCCGGATCTCCGCCTCGGACAGCTGCACCTGCCGCCCGCCGCGGCCGCCCTCGACC
AATCGCCGCACCACCTCGTCCAGCGCCGCGCCCTCCATGGCCCCCATGGAGGCCCGTGTCATCATCATCTTCCCTCCTTCTTCTCCCGCGGCCGCGTCCC
TCTCTCTCTCTCTCCGGCGACGGCGAGGGGCGGGGGAGAGAGAGAGGAA
page-top