Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3468  (registered. 2012)
Contig Information
Length 973 bp
Clones alternative view 31 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_yd Spikelet at late flowering 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 4
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 2
WH_XA Root 1
WH_XB Root 6
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|42541150|gb|AAS19468.1|| delta tonoplast intrinsic protein TIP2;1 [Triticum aestivum]
Score 407
Evalue 1.00E-111
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3468
TTCCTTTTCTCGGCCATTCTAAGCCACCATGCCGGGCTCCATCGCCTTCGGTCGCTTCGATGACTCCTTCAGCTTGGCCTCTTTCAGGGCCTACATCGCC
GAGTTCATCTCCACCCTCATCTTCGTCTTCGCCGGCGTCGGCTCTGTCATCGCCTACACCAAGGTGAGCGGCGGCGCGCCGCTTGACCCATCCGGGCTGA
TCGCCGTGGCGATTTGCCACGGGTTTGGGCTGTTCGTCGCGGTCGCCATCGGCGCCAACATCTCCGGCGGCCATGTGAACCCTGCCGTCACCTTCGGCCT
CGCCCTCGGCGGCCAGATCACCATCCTCACCGGCATCTTCTACTGGGTTGCCCAGCTCCTCGGCGCCATCGTCGGCGCCTTCCTCGTCCAGTTCTGCACC
GGCGTGGCCACCCCTACACACGGGCTTTCCGGCGTGGGCGCCTTTGAGGGCGTCGTGATGGAGATCATCGTCACCTTCGGGCTCGTCTACACCGTGTACG
CCACCGCCGCCGACCCCAAGAAGGGATCCCTCGGCACCATCGCCCCCATCGCCATCGGCTTCATCGTCGGCGCCAACATCCTCGTGGCCGGCCCCTTCTC
CGGCGGGTCCATGAACCCTGCACGCTCCTTCGGCCCCGCCGTTGCCAGCCATGGGAAGAGTCGTTCGGTCCATAATGCCTTCGGCAACATAAAAAGTGCG
TACGTGGTGGGCAGTCTCACGAATGTCTCGATGATGTGAAGAACATCCTGTTGTTTGGTTCAGATCGAAGCTGTAGCTGGATGATGCATGTTCCTTTATC
TGTAAAATGTGATGTTGTGAAGTTGGTGGGGTTTGAGAATTCTTCAGTTGAGTTTCCTTATGCGATTCAATAAGAACATCATTGTTTAGTGCATCCAAGA
CCTCGCTGTGATCCTTCTCTGTTTGTACTTTTTTTTCCCGAATTTTCTCTGTTTGTGTTATGTGTGATATCGC
page-top