Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34655  (registered. 2012)
Contig Information
Length 760 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_RDr Root of dessiccated seed 2
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|194708042|gb|ACF88105.1|| unknown [Zea mays]
Score 338
Evalue 4.00E-91
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34655
ATCTAGCTACAACTACACACAAATCCCCACCCCCTTATAATGGAGGGGCTTTGAGCCGCTGTCCCTGCCTCCCCACACTGTCTCCAACATTTCCGTTGAT
GTTCTGAACCATCCTCTCTTGCTACCACTACATAATAGTGCCTAGACACCGCCGATACCAATGCAGAGAACGATGGTTCTCCGGTTCTCTGACCACTCAT
CTGAGGCTGTTCACGAAGGCGAGGAGGGACTGGACGTCCCTCTTCTCGGACGGGTACTTGATGGGCTTCACGGTGCGGCCGGGGAAGAGGAGGATCGTTG
GGAAGCTCTGCAGCTGCAGCTCCGCCTGCGCGAATGGCTTCTGCTCACCGTCTGCACGGAACTTGGCCACCTTGATGCCGGAGCCGCTCAGCTTCTCGGC
CAGCTCAACGTAGGACGCCTCCATTGCCTGGCAGTATGGGCACCAGGGAGCGTAGAGGACGGTGAGCCACGGCTCGGCGCGGTTCTCCAGCCGCAGGAGG
TTCTCGATCCCGGGACGGGTGAGGTTGACGATTGCCTGGCTCTGGAAGATGTCTGGGGCGCTGGCCTCGGCCGAGCCGTTGCCGTTGACGCCGACCTTGG
GTGCCTGACCTTCCTTGTCGATGTTACCCTTGTGGAGGCCGCACTCCTTGGCCGTGGCGTCCTCCCACCACCACCTCCCTTCCCTCTCGTGCTGCCCCGG
CAACACGGGCCTGGTGCACGGCTCGCACCCAATGGAGACGTAGCCTTGAGCATGCAGGGT
page-top