Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3459  (registered. 2012)
Contig Information
Length 1285 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 1
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 1
Wh_EM Dormant seed with water absorption 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_VSCB Liquid cultured tissue 1
WH_XA Root 2
WH_XB Root 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|109716218|gb|ABG43091.1|| histone deacetylase HDAC2 [Triticum aestivum]
Score 602
Evalue 4.00E-170
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3459
CGACTAGACCTAGGGCTCCTCCGACCACCGCCGCCGGTTGCCATGGAGTTCTGGGGCCTTGAGGTTAAGCCTAACCAGTCCGTCAAGGTTTCACCTGATG
ACGAGCACTTCCTCCATCTCTCCCAGGGTGCCCTTGGTGAAGTGAAGAAGGATGACAAGGCAACCATGTTCGTCAAGATTGGCGACCAGAAGCTAGCCAT
CGGGACCCTCTCTACTGACAAGTTCCCTCAGATCCAGTTTGACCTCGTCTTCGAGAAGGAGTTTGAGCTCTCACACAATTCCAAGACGTCCAGCGTCTTC
TTCTCTGGCTACAAGGTCTTCCAGCCTGCCGAGGGAGATGAGATGGATTTTGATTCCGAGGACGAGTCTGAGGAGGAGGAGGAAGAGAAGATCATCCCAG
CACTCACCAAGGAAAACGGCAAACCTGAAGCCAAGGAGCAGAAGAAGCAGGTTAAGATTGACACTGCTGCACATTCAAAGTCAAAGGCTGCTGCCAAGGA
TGTGGGAAAATCTAAGAAGGATGATGACAGCGATGACGATGATGACAGTGATGAGGATGACAGCGAAGATGACTCTGGTGATGATGGAGCATTGATTCCC
ATGGAGGATGATTCTGATGATAGTGAGGATGGTGATGATTCCTCTGATGATAGTGAGGATAGCTCTGATGAGGAGGAAGAAGAAACACCCAAGAAGCCAG
AGACTGGGAAGAAGAGGGCGGCTGGAAGCGTGTTGAAGACCCCTGTTACTGACAAGAAGGCCAAGATTGCAACACCGTCAGGCCAGAAGACAGGTGACAA
GAAGGGAGCTGTCCATGTGGCGACTCCTCACCCGGCCAAGAAGGCAGGCAAGACCCCGGCTACCAGCGACAAGTCGCCCAAGTCTGGAGGGTCGGTCGCG
TGCAAGTCGTGCAGCAAGACATTCAACAGCGAGGGCGCTCTAGCTTCGCACTCCAAGGCAAAGCACGAGGCCAAGTGAAGAGGAGAGGAAGGTGTTGGCT
GGCTGGCTGGCTCCAGTTGCTATTATTTTGATCTGTCTGCCCTATTGAGATTATTATCGTTATGCTGCTGTGTTAGGCTATCTGCTATATCTTATTATGT
TGTCGTACCTACCTAGCCTGATCCCGAGGGAAGGGAGAAACCGTTGAGCTGTTAGTGTTGATGCGTTTGTTGTTGAATCGAACAAAAAAGCCGCTGTGAT
TCGGAATTGGAATTGGTTGGTGGAATGCTATGGTCATCATGGTTTTGAATGAATGAATCCTGTGTGGTTTGGGACAAAAAAAAAA
page-top