Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34566  (registered. 2012)
Contig Information
Length 692 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|82780762|gb|ABB90550.1|| putative steroid membrane binding protein [Triticum aestivum]
Score 405
Evalue 2.00E-111
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34566
GCCCCGCCCCTCATCCCCGAAGTCTCCAAACCCCTCGTCGGAAGAGGTGAGCAAGCCTTCACGATGGCGGTGGCGGAGCTCTGGGAGACGCTGAAGCAGG
CGATCTTAGCGTACACGGGGCTGTCCCCGACGGCCTTCTTCACCGCCGTGGCGGTCGCCGCCGCGCTGTACCACGTCGTGTCGGGGATCTTTGCGCCGCC
GCCGCCTCCCCGGCAGCGGCCGCTCGAGGAGCCCGAGGCGGAGCCGCTCCCGCCGCCCGTGCAGCTGGGCGAGGTCGACGAGGAGGAGCTCCGGCAGTAC
GACGGGTCCGACCCCAAGAAACCCCTCCTCATGGCCATCAAGGGTCAGATCTATGACGTCACGCAGAGCAGAATGTTCTACGGACCTGGTGGACCTTATG
CCCTATTCGCTGGCAAAGACGCCAGCAGAGCTCTAGCCAAGATGTCTTTCGAGCCCCAGGACCTGAACGGTGATACCTCTGGCCTCGGGCCGTTTGAGCT
CGACGCCCTGCAAGACTGGGAATACAAGTTCATGAGCAAATATGTGAAGGTCGGCACCATCAAGAAGGCAGCTCCCGCAGAAGACGGCACCACAAGCACA
TCCCCAGAAACAAATGAAACAGTCACCGCCGAGGCAGAGACCGAGAAGGCACCCGCCACGGAGCACAAGCCGAGGGAGGTGAGCTCGGAGGA
page-top