Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34530  (registered. 2012)
Contig Information
Length 815 bp
Clones alternative view 125 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 9
Wh_dL Crown of seedling 12
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Wh_r Root 11
Wh_yd Spikelet at late flowering 4
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 13
Wh_EMI Dormant seed with water absorption after breaking 5
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 4
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23Ž 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_SP 6
WH_XA Root 8
WH_XB Root 11
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XD Root, treated at 50 microM Al for 6h 7
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226533355|ref|NP_001151634.1|| LOC100285268 [Zea mays]
Score 301
Evalue 7.00E-80
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34530
TTTTTTTTTTGCACACAGATAAACTTAATAACATTAATCAGATCTAAACGACAAACAAAGAACCAGATATTAAACATATAATGAAGTCTTCATATCAAAA
TCCAAGGCACAGACCCATAAAGATGCACATTAAAGGTTTGAAAACGCTCATCCACGACATCATACGAATAATAAAGCAGTCTTCAGATAGCATATCCTAA
CAGAACTGGTGATGGTAATAAAACTAGGATATCAAGAGCAGTATGGCAACCGGCAGATCCCAAGCTTAATCGATCTCCTGGAGCGAGGCACCGGTGGCCG
TGGCGCCCCCAGCGGCGGCGGCGACGTCCTCCGCCGTGAACTTTCCCTTGGCCTTGTCAGCAGCGCGGCCGCGAGCCTTGCGGTCGAGGAGGGCCTTGCG
GTCCTTGTCGAGCTTGAGCTTGGTGACGATCACCTTGCTGGGGTGGATGCCGACGTTCACCGTGGATCCATTGACCTTCTCCCTGGTGATCCGCTCCACG
TGGATGACCCAGCGGCGGCGGTAGACCTGCACCACCTTTCCCTCGCGGCCCTTGTAGGTGCCGCGCACGACCTGCACCTCGTCGTCCTTGCGGATCGGGA
TGGAGCGGACGTTATATTTGTGGCGGAGCTCGGAGGAGAGGGCCGCGGACATGAGCACGCGGCGGACGGAGGACGGCGCCGTGAAGTGCGCCTTGCGGCA
CTTCCGGCGGGAGCTCGTGACGCGGGGGTTGCGCTTCATGGCGGCAGCGGGGGGTGGGCTCTCTCCCTTACCTGGGGCGTCGGCGGCGGCTAGGGTTCTG
GGGCGGGCCTCGTGC
page-top