Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34501  (registered. 2012)
Contig Information
Length 734 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115456051|ref|NP_001051626.1|| Os03g0805200 [Oryza sativa (japonica cultivar-group)]
Score 238
Evalue 4.00E-61
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34501
CGGCTCCTCTCCCCCACCTTCCTCCCTTCAACCTTCGATCTCCTCTCCCCCCGATTCTCTAGGGTTTCTCCCGACACCCGCCCCCCGCAGCCCCCAACCC
CGCCGACTCCGACCCGCTCCCTCCCTCCCGCTCGCTCGCCGCAGGTTTTAGCGATCAGCCGTAGCTCTTTCATCAAAGGTTTTGTGCAAAATTATGCGAT
CTTCATGGGCTGATTCAGTTGCGAACGCCGAGGAATCGGCGCCCGCGACTGGTGCTGCTCCCGCCCCTGTTGCCAATCACCAGAACTCGCGTCCCACTCG
CAGCTCTTACGTCCCTCCTCACCTCCGTGGCGGTGGCCGCTCACCAGAGAATCAAGTGCCAGCTGCTGCTCCAACACCAGCTGGCGCATACCCCTCAGGT
GCTGTGCAGCCTTCTGGTGGGTACGCAGCTGCTGTTGGTGGTACTCGCTGGGCTGCCCCTCCTGGTGCTCCTAGCGCTGGCGTAGGCGTTGTCCGCCAGG
GTGGTGGTGGACGTGGTGCTGTTGGTGGCGGTGGTGGCGGCTGGAACTCCCGCCCTGGTGGGTGGGGGGACCGCANNGACCGTGAACCAAACCCTTTTGG
CGATAGTGAGCCGGCGGCTGTGGATGTTGACTTTGAGAGTCAGCAGAACACGGGCATCAATTTTGACGCCTANNNNNNCATTCCTGTGGAGACAAGTGGC
CACGATGTGCCTCCAGCAGTCAACACGTTTGCAG
page-top