Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3446  (registered. 2012)
Contig Information
Length 965 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 1
Wh_r Root 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XB Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226499354|ref|NP_001147027.1|| polyubiquitin containing 7 ubiquitin monomers [Zea mays]
Score 450
Evalue 1.00E-124
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3446
ATATAGCCAGACAAGAACTGCAAAGGCAAATGAGCACAGGCACATTACGTTCAAAGTTGACTTATTCATACTCCACTTAACGGTACAGATGTACCTGCAA
CTGTTTGCACCAAACCACAGGACTCGATGGTCCATTAAACCAGACACAGTACACAAACGAGACAACACTTGAACAAAGGCGCACCCACAGGACGACACAG
GGTACAGCAGCAGCAGCAGGTCGAAAGATAGGGCAATTACTGACCACCACGGAGGCGGAGCACCAGGTGAAGGGTGGACTCCTTCTGGATGTTGTAGTCG
GCGAGGGTGCGACCATCCTCCAGCTGCTTGCCAGCAAAGATCAGGCGCTGCTGGTCCGGGGGAATGCCCTCCTTGTCCTGGATCTTGGCCTTGACATTGT
CGATAGTGTCGGAACTCTCAACCTCCAGAGTGATGGTCTTGCCGGTGAGGGTCTTCACGAAGATCTGCATGCCACCACGCAGACGCAGCACAAGGTGGAG
GGTGGACTCCTTCTGGATGTTGTAGTCAGCAAGGGTACGGCCATCCTCCAGCTGCTTGCCAGCGAAGATGAGACGCTGCTGGTCTGGGGGAATACCCTCC
TTATCCTGGATCTTGGCCTTGACATTGTCGATGGTGTCGGAGCTCTCAACCTCAAGGGTGATGGTCTTGCCGGTGAGGGTCTTCACAAATATCTGCATGC
CACCACGCAGACGCAGGACAAGGTGGAGGGTGGACTCCTTCTGGATGTTGTAGTCAGCGAGGGTACGGCCATCCTCCAGCTGCTTGCCAGCGAAGATGAG
ACGCTGCTGGTCCGGAGGAATGCCCTCCTTGTCCTGGATCTTGGCCTTGACATTGTCGATGGTGTCAGACGACTCCACCTCAAGGGTGATGGTCTTGCCC
GTCAGTGTTTTCACAAAGATCTGCATCTTGAGGCGGTGGGGATTCGACGAGCCTGGAGTCGATCG
page-top