Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34449  (registered. 2012)
Contig Information
Length 881 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 3
Wh_SHDr Shoot grown with dessication 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig34449
GCATGATGAAGCATGAAAGTCAGACATTACAAGAGGTTGCACGTCCACACATCTTCGTGGAGCACAAATTCGGTATGAATGAATTCACATACGGGCACCA
CATTCAACTCGGTATTATTAACTGGGTTGCTGATAAACATCAGTCAAAGTAGGTCGATGACTCTGTCGAATGGAAGACTAGTGGCAGGAGCATATATAGT
ACGTACATGGTGCTCCAAAGCCGTGAAGCAACAAATGATTACAAGCCTGACTGAAGTGTGTCTGCAATCTGCAGGAAATTCTGTAAAATTTTGTTGAAAT
GTTGAGCTAAAATTCTGTAAAGTTTAAACAGGAGACTGCCTTGTAAAATTAAACAGAGATTGCAAATCTGATTTTCTGTGGGATGGCAAAGCATACTGAA
ATCACGCAGAGCAAATTATAACTCGTTTTTTCTGTGGGATGGGATACCACGACAATCAATCAAATCAACCAATCGACGACAAACAAGCAAAGGGATCAGC
TCCGCTCCGCTTGGGGCGATGAAGATCTTCCAAACATACATAGTATATTATATAGAGAAAGAGTAAAAGCGGAATTAAGAACAAAGTTCCCGTCTCAACT
CGCTCGCCATCAGGCATGCTAGATCCGTTGTTTCTGCCTGCCTGCCTGCGCATAGTGGATAGATCCGTTGTTTCTGCCACAGATGCGGCGCCGATGGATC
TGTGAATCCGTGGGCAGACAGGCGCGCCGATGGATGTCATGTATCCATCACTGGGCAGAGGGAAGAAGGAAGGAAGGCTTCCCTCGGAGCCACGGTTGGG
TTGGGTTTGCTTTTGGGATGAGGGGCTCTGCTTCTGCGCAAGGTCAGCGGAGGGGAGGGGACGAGAAGAGAGGAGAGGAGA
page-top