Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34412  (registered. 2012)
Contig Information
Length 2031 bp
Clones alternative view 33 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 6
WH_XN Leaves, plant was grown at constant 23 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 7
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115434360|ref|NP_001041938.1|| Os01g0133400 [Oryza sativa (japonica cultivar-group)]
Score 887
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34412
TTTTTTTTTTAAATATCGCGCTTTTTTTTTCGGCAAATTGGAGTTTTATTACCGAGTTCCGACACATATAAGGAGTTCATCTGTACACTGAAAACGATGA
CATCCGATCCAAGGACTAACAGCCAGCCTAAATCTCGCACCTCCTGAAGCAATGCCACAAAAGCTCTTTGATTCTGAGATGTGACAAGAGATAGCTGAGC
TTTACTGGTGCCGCAACACCCTGAGCACCAGCCGGTTTGCATGGCGCCAGGCGATCTTGCGGCTCGCTTATTCCAGGAACTACTCATAAACGGCAGAGAC
AACATCCCCAGGTCCCAAGGATGAGGCGCTTGTGCTCGGTGCTCATTGATCGCTCACCAAGAAAGCATTAGCATCGGCTTTACTGGGCGGGCTTAGCTCC
CGCTCAATCTCTTCCAGGGATCGCCCCTTGGTCTCGACCACATTCCCGGCAATGTACAGGACTGCGAGAGCACACACGGACGCGAATCCCAAGTACACGG
TGCTGATTCCAAACTTGTTGACGACGCTCAGGAAGTACAGGCCGATGAAGAAGTTGGATACCCAGTGCATGCCCATTGATAATGCTACAGCCTTGGCCCT
TATTCTGGAGGCAAATATTTCAGGAAGGAGCAAAGCTGGAACAGGGCCAGCTCCAAGAGCGAATGACAGCACATACAGGACAGTGCCCACAACAGCAAGA
GTGCCAGAATAAGGTGCCAAAGCCTTCCAGGTGAAGGACAATGACAAGAGTAACATCGACGCCGCCATCCCAGAAAAGCTTGTTATGAGAAGGCTCTTCC
TCCCTTGCTTGTCCATCAGTGAAGATGCAATCATGGTGCCAAAAACATTCGCGGCACCAACAAGAGCACTCGCTGCAACATCAGATGCAATGCCTGCACT
GCGGAACACTGATGTAGAGTAGTACACAACAGCATTTATGCCAGCAAGTTGCTGCAACAAAAACAGTGCCGCTCCCACGCTCACAACTTTCCAATAGCGT
TTGCTGAATAGATCAAACCAGTTGGCATCTGGCTCATTAGATCCTTGCCCACTAGCCTTCAGGTCATACATGACTTCAGTAACCTTCTCTTTTCCATACA
ATTTTTTTATAGCTGCTTCTGCTTGAGAAATCTTTCCTTGCTGGAATAGCCAGCGAGGGCTTTCAGGTGAAACAGCCATTCCTAGAGCCAACAAAATAGA
TGGAACTATTGAAATTCCAAACATTGTCCTCCACCATGCAGGATTTTGTGCTAATGGCAATCCAGCTACCAAAGCTGCAAGAATTCCAATGCAGATAAAC
AGCTGATTAATCGTACCAAGTGCTCCACGTATTTCAGTTGGTGAGATCTCAGATATGTAAAGGGGCACAAGAGCAGAAGAGATCCCAATACCAATCCCAG
CAAGTAATCGACCAATAATCATTGTACGGACATCTTGAGCTGTTGCACTCAAGAATGCGCCTACAGCAAGAGGGATTGCATCTAGGATAAATGTCCGTGT
TCTCCCTAATTTATCAGCCAAAGCCCCTCCAGTAAAAGAACCTACTGTCGCGCCAGCCAGGGTTGTGCTAACCACCCATCCTTGTAACACAGCATTTTCA
GCAATCCCAAGATCTTTCGAGAGATATTCAAGTGCGCCATTGACCACACCAAGATGGTAGCCAAACAGAATTGCCCCCAAGCAAGCAACGCCAACGTACG
GCAGAACACTCCCAGAAGATTTAGCTTGAAGCTTGTCAGATGGAATATCCTCGGGGTCAGCTGAGGCCGTGGCGCGCACGCGGCCGTAGCGCGTGCTCCG
GAAGAGCCCCGCGGCGCCGGCGCTGGGCCTGCCCATCTCGAGCCCCGCGAGATCCGCCGCGCGCGACCTCACGCCGCCGCAGCAGAGCCCGCCGCGCCCC
TCCGACATCCGCACGACGCTCCTTCCGCTGCCGGGCGACGACGACGACGGCGACCTCCGCTCGCCGATGACGACGTGAGCACCGCCGCCCCTCACAGCGC
ACCGCATCATCTTAACGGGGGGCAGAAGGGG
page-top