Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig344  (registered. 2012)
Contig Information
Length 1339 bp
Clones alternative view 49 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_r Root 1
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_RDr Root of dessiccated seed 9
Wh_VSCB Liquid cultured tissue 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 5
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 7
WH_XV Leaves, plant was grown at constant 23 1
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|158701881|gb|ABW77317.1|| NADP-dependent malic enzyme [Triticum aestivum]
Score 683
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig344
CTATTACACTCGTTTAACTCAATCTGACAAAAGAATCGACGACGACGACGACGACGCACCTCGACACGGATAGACAGGTGCGTGCCGTGCTCCCGTTAAC
AGTACATTACAGTACAAAGTAAAGCAAAGTAGAAGAGCACAAGAGTACACATACGCATAGACGGACACAGAAGGAAAGAAAGCCTATGTTTTAGGTTGCG
TCGCTGAAGCTTTGAGTTGAGCTGGTTGGCATACGGGGGAAGGAGATTGATTTTATTGATTGACTCCGTCCGTGCTGGCCGCAAAACTGCCCGCCACGCT
CACCTGTAGCTGCGGTAGAGCGGGGTGTACATGCAGCTCTCGGCGTACTTGACCAGGTCGTCGGGCCGCGGCAGCCGGCTGGCCAGGCCCAGGTCGTAGG
CCTTGGCGGCCACCTTGGCGGCGATGCTGGCCGAGATCTTGCGGATGTTGGTGAAGGGCGGGAAGATGAGCCCCTTGTCGAAGTTCTCCTGGGTCGCCTC
CTCCGCCAGCGCCTCCGAGGCGGCGAGGAGCATGTCGTCGTGGACGCGGATGGCGCCGGAGATGACGACGCCGAGGCCGAAGCCGGGGAACACGTAGGCG
TTGTTGGACTGCCCGGGCACGAACGTCTTCCCCTCGTACTCCACGGGGTCGAACGGGCTGCCGCTCGCGAACACCGCCGTGCCCTTGCTCCAGGTGTAGG
CCTCCTCGGCCGTGCACTCCGAGTGGGACGTCGGGTTCGACAGCGAGAAGATGACGGGTTTCTCGTTGAAGGAGGCCATGGCCTCGATCACTTCCTGGGT
GAAGGTCTTCCCGACGCCGGAGGTTCCGATCAGCACGGTTGGCTTGATGGACTGGACGGCCTCCAGCAGGGTCTTGAGTTCTTCGTGCTCATGAGCGAAC
GGCTTCTTGAAGTGCTGCAGAGACTCTTTTCTAGACTCGACAAGCAGACCCTTGGAGTCCACCAGCCAGATCTTCTTGCGGCAGTCGTCCACCGGGAGTT
CAGTGTGTTTCGACATCTCAAGAGCAATGAGTTCTGCAATGCCAGTTCCAGCCTCTCCAGCACCAAGGAAGAGGTAAGTCTGATCCACAAGGCCTCCACC
GATCATCCTCAGGGCCGCCAAGAGGCCTGCGAGGACCACTGATGCTGTGCCCTGAATATCATCGTTGAAGACGAGATGGCTCTTGCTGTACTTTGCGAGC
AAATCGAATGCATTGTGGTTGGCAAAGTCCTCAAACTGGACCAGGACTTTCTCGCCGTAGTTCTGCTTCACTGCATTCATGAACTCTTGAAGAAGCTCAT
GGTATTCCTCGCCGGTAGCACGCCGTTGACGGAGCCCGA
page-top