Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34376  (registered. 2012)
Contig Information
Length 1506 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|61658230|gb|AAX49504.1|| UDP-D-glucose epimerase 1 [Hordeum vulgare]
Score 402
Evalue 8.00E-110
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34376
CACATAACAAGTAGTATATTATACCAGTACGGAGCTGAACAAATAACAAGTGATTAAAACTAGTCAAGTCTGAATATTACACAATTCTGAACATTACACT
ACTCTGAACATTACACTACTCAAGGTTACAGAAATTTGAGAGAGAGAGAGAGAGAGCAGCAGGTTCATGGGAGAGGGAGCAGCAGCAGTTTGGTTCAGAG
AGAAGCAGTGGCAAGGGGTCCCGGAGAAGAAGCAGCAGAGGCAGCAGGTTCAGAGAAGGAACTGAAGGAGTTGGAGAAGAAGATTAGGAGCAGCAGCAGT
TCAGCAGGGGATTCAGAGGAAAAGCAGCAACAAGGGGCGCAAGAAGAAGCAGCAGCAGGTCATGTTGACGAAGAAGCAAGAGGTTCGTGGGGAAGAAGAA
GAAGCAAGAGCAATAGCAGAGGTAAGGGAAGAGAAGAAGCAGAGTAGACTCGGGAGAAGAAGCAAGCAGAAGGGCGCAGGAGAAGGAGAACAGCAAAACG
GGGGCACCCTCACGCGGATGACCAGACACCTGTGCTCCCCTTTGTCTGGTTGGGCGTGCGAGGTACGGCGGTGGCTGGAGATGGTGGAGGGATGGATCGA
TGATGGTGGATGCTGGTGATGGCGCGGTGGTGCGGCTGCGATGGATGGATGGTGCAGGGGGAGGAGAGTGGTGGCGCGTGGTGGAGGTGCTGGGTGGCGC
GCCGCCACGCTGGCCTGGCCGCGGGAGACGCACAACTCCCCCTCTCTCTCCCTCTCTCAGAAACAAACAAACAAACCGCTCTTGTCTCCCATTCCAATCT
CGCCCCGTCGGTCGAATTAGAAGAAGAAGAAGAGGAATCAGAGGAAGAAGAAGATGGTGTCTGCGGTGCTTCGGACGATCCTGGTGACGGGCGGCGCGGG
GTACATCGGCAGCCACACGGTGCTGCAGCTGCTGCTCCAGGGCTTCCGCGTCCTCGTCGTCGACAGCCTCGACAACGCCTCCGAGGAGGCCATCCGCCGC
GTCCGGCAACTCGCCAACGCCCCACAAAACAGCCTCGACTTCCGCAAGGTGGACCTTCGTGACAAGGAGGCGCTGGACGAAATCTTCTCGACCCAAAGGT
TCGAGGCTGTGATCCACTTTGCCGGGCTGAAAGCCGTGGGGGAGAGCGTGCAGAAGCCCCTGCTTTACTACGACAACAACCTCATCGGCACCATCACCCT
CCTCCAAGTCATGGCAGCACATGGCTGCAAGAAGCTTGTGTTCTCATCATCAGCCACTGTGTACGGGTGGCCCAAGGAGGTGCCCTGCACTGAGGAGTTC
CCGCTCTCCGCGACCAACCCTTACGGCCGAACTAAGCTTGTCATTGAAGACATCTGCCGCGACCTCCAGCGCTCGGACCCCGACTGGAAGATCATCCTGC
TGAGGTACTTCAACCCGGTCGGCGCGCACCCGAGTGGCTACATCGGGGAAGACCCCCTCGGNNNNNNNNACAACCTGATGCCCTATGTCCAGCAAGTCGC
TGTCGG
page-top