Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34372  (registered. 2012)
Contig Information
Length 831 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XV Leaves, plant was grown at constant 23℃ 6
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 7
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218194006|gb|EEC76433.1|| hypothetical protein OsI_14121 [Oryza sativa Indica Group]
Score 167
Evalue 1.00E-39
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34372
TGTCTCGAGAGATAAACAAGGTGCGGAGGACGAGACTCGGAGTCGCTCAAACAAACCCAAGCCCAGCTTGTTTATACTCCACTTTACACAAGAAGCCATA
CGTGTTTATACTCCACTTTACACAAGAAGCCATACGTGTTACAGAGTCAAGTCAACAGGACAAGCCGCGCCTAATTAACAACAAAAAAAGGTGGCCGGCT
GGCTGGCATCTCTGGCCGTGATGCCATCAAGATTCGTCCGTCGCCGGTGGCGGTAGGTGGGGTGGGCGGTTGGTCAGCTGGTCGGTTGCCCCGGCCGGTC
ACGGTCAGTGGGCGGCGATGGCGCTGCAGCGCCGCTGGCAGAAGTTGGGGACGCGGTCCATGCACTGGTACACGGCCGGGTGCACGGCGAGGGGGGACCT
GACGCAGTCCCGGCACGCCGGGTGGCACCCGACGGGCGCCGCGTCCATGCACCGGCACTGCGGCGTGTCCGACTTGGTGCACCCGCCGCAGCTGTCGCAG
CACGGCCACGCGCTCCCCCTCGCCTTCGCCGCCGCCGCAGCCGCCGACTGCTCTTCCTCTCCTCCGTGCCCTCTGCTTTGGACGCGGGAGTGATGGCCAT
GGCCGTGGTGGTGGTGGTGGCTGCTGCTGGATTCGGCGAGCGGAGGAAGAGCTGCGAGGACGACGGCGAGGACGCCAAAGATCACCAGCAGCGGCAGCGC
CGGGCTTCTCCTTCTTCCCATCTCTGTCTCTCTCTGCTTCTCTGCCTCTTCGATTTCTTTCCTCTCTTGCAAGAACTGGCGGGCGTGGAAGACTTGCTCT
GTTTGCTGGGTCTCTCTGGCTATGGCCTCTA
page-top