Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34347  (registered. 2012)
Contig Information
Length 885 bp
Clones alternative view 197 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 1
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 1
Wh_OKCS Seed DPA5 2
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VSCB Liquid cultured tissue 3
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 56
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 9
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 21
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XE Seedling, infected with leaf rust 3
WH_XF Seedling, infected with leaf rust 17
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 22
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 8
WH_XV Leaves, plant was grown at constant 23Ž 15
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 12
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115486573|ref|NP_001068430.1|| Os11g0671000 [Oryza sativa (japonica cultivar-group)]
Score 189
Evalue 4.00E-46
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34347
CCTGCACTTGATCTTATCGGTGGGTAGTAGTACGAGCGAGTGACACAAGTTCTTGCACCGATCAGATCCAACTTCTGCGCAAGATGCTGGACAAGCTGTG
GGACGACGTGGTGGCCGGGCCTCGCCCGGAGACGGGCCTCGACAAGCTCCGCAGGGCGGCCGCCACCCAACCTCTCGCCATCAACACAGCTGCAGGGGAG
GCGATTAAGCAGTCGCCGTCGATGCCGACGACCCCGACCACGCCGGTGACGCCGTCGTCGTCGACGCCCCCGCGCGGCGGCAGCGTGTGGCGGAGCGTTT
TCCACCCCGGGAGCAACCTGGCCACCAAAAGCCTCGGCGCCAACCTCTTCGACCGCCCGCAGCCCAACTCCCCCACCGTCTACGACTGGCTTTACAGCGA
CGAGACCAGGACCAGGAGCAACCACCGCTAAATAAGAGCCGTCGGCCGAAGAAGAAGAGAGGGTGCTCAACAACTTCTGCGACGCCGCCATGTTTGCTGC
TCTTTTGGTTATCTAATCCTGCATAGCGTACGTTGCCGTCCGAGGCTGCATGTGGTTTGTCTTGAGCTTCGTACTACTGTCTACTAGTGCTTGTAACTTT
CTTTTCTTATCCCGGTCTGCTCACTGCATGCTAGCGAGTGATGGGTGTGTATGTGTGTACTTTGTGTACGCTCCATGTGTAAATTCTCGTGTGTGTGGTG
TGGTGTTCTCAATGTTTAACCACCTACTATGGTAAGACAATAACAGCCTCAGAGCAAGCTTTTCCTTTTTCAAATAAAAAATTCATAGACAATAACACCA
TATTTATGAAGGAAAACAATAGACAATACAATGAACGAAGTGATATCCTAGTGGTATCCCAACCCATGAGGGTTCAAAAAAAAAA
page-top