Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34343  (registered. 2012)
Contig Information
Length 1608 bp
Clones alternative view 92 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 1
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 1
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 1
Wh_VWD Shoot grown with dessication 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 10
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XA Root 11
WH_XC Root, treated at 50 microM Al for 6h 22
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XF Seedling, infected with leaf rust 5
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 12
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|68655495|emb|CAJ01713.1|| methionine synthase 1 enzyme [Hordeum vulgare subsp. vulgare]
Score 781
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34343
CTACTTAAGTCTGGCCCAAGGCCACACTTGCACACACACGCTTACATGGCCGCGGCCCAACACTACAATTGCACTGAGTGCCTCGCTGTACGCTTCAGGG
TTCAGTTAACTGCTGGACTGAACCTGAAGGCGTTACACCAACACAGCCAAGACAAGAACATCCGGAGAAATTTTGTAATTTGAAAACGTAACGTAACAAA
CTCATGACTTAGATGATGAACAATTCGCCACTCAGTTTACAATACACACCGACAACCGCCTCAAAAACCACCAAATCAAAGGGATGAGCACATGGCGCCG
CGCCGCGCCGAGAAACAAACTAGCCTAACCAACAGGTGGATACAGAGACCCAGATTATTCAAAGTAAACACGGCTATGGTGGCGACATCCTCCTTGCAAT
TAAAATGGGGGAGCTGCTATACGGCTTACTGCGCCTTGGCGAGCTCGGCGCGGATCTGCTTGGCGGCCTCGACCATGTTGGTGAGGGCGGGCTTGACCTC
GGCGTACTTGCGGGTCTTGAGACCGCAGTCGGGGTTCACCCACAGGATGTTGGTATCGAGCACCGCGAGCATCTTGTTGACACGGTCGGCGATCTCCTCC
TTGGACGGGATCCTGGGGGAGTGGATGTCGTACACGCCCGGGCCAATGCCGGCGCCGTACACCACGCCCTCGCGGAAGACGGAGAGAAGCTTCTCGTCGG
ACCGCGAGTTCTCGATGGTGATCACATCGGCGTCCATGTTGATGATGGACTGGATGATGTCGTTGAAGTTGGAGTAGCACATGTGGGTGTGGATCTGGGT
GGTGTCCTGGACACCGCAGTTGGTGATCCTGAAGGAGTGCACGGCCCAGTCCAAGTAGAAAGCGTGCTCCGACTTGCGGAGTGGCAGACCCTCTCTCAAA
GCAGCCTCATCGATTTGGATAACCTGAATACCACCAGCCTCAAGGTCCTCGACCTCCTTCTTGATTGCAAGAGCAATCTGGTAGCAAGTCTCAAACCTCG
GTTGGTCATTTCTGACAAAAGACCAGTTAAGGATTGTGACAGGGCCTGTCAGCATACCCTTCATTGGGCGAGCAGTCATGCTCTGCGCCATCTTGGACCA
GAAGACGGTCATGGGGTTGGGGCGGCTCACATCACCATAGATGATCGGTGGCTTGACGCACCTTGATCCGTAAGATTGCACCCAACCATTGGCAGTGAAC
GTGAAACCAGAGAGCTGCTCACCGAAATACTCAACCATATCGTTCCTCTCAGGCTCTCCGTGCACAAGCACATCAATGTCAAGCTCTTCTTGGATCTTAA
CAACCTTGCTAATCTCCTCCTTGATGGCATTGGTGTACTCCTCCTCAGAGATCTTCTTTGCCTTGTACTCACGGCGGACTCTCCTGAGCTCCACTGTCTG
TGGGAATGAACCAATGGTGGTCGTGGGAAGGATCGGAAGGTTGAGCTTCTTTTGCTGCGCATCCAACCTAGCGCTAACGGTGGTAGCACGGCGGTGATCA
GAGCCCTTGAGGGCGGTGGCAGCCTTCTGGACCTCCTCATTTGTGACACGTGGTGACGACCTTCTTGAGGCCAGAGCAGCAGCATTTGCAGAGAAGTAAG
CCTCATCC
page-top