Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3433  (registered. 2012)
Contig Information
Length 900 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242060618|ref|XP_002451598.1|| hypothetical protein SORBIDRAFT_04g004420 [Sorghum bicolor]
Score 402
Evalue 3.00E-110
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3433
TCTCCGTCGATTCCGACGCAGCCGCCGCCGACTCCTCCTCCTCTACCTCACCGGAAGGCCGCCTGGCCGCGCGCCTGAGCCGAATCCCTCGCCCTGCCTC
CCGCGATTCAGACGTGTTTCCTGGCTGCGTGGAAATGGAAGGCGTTGTTGTGAGGAGAGTCATCCCTTCAGACAACAGTTGCCTCTTCAATGCCGTCGGT
TATGTGATGGAGCATAACAAAAATAAGGCTTCTGAGCTCAGACAGGTCATAGCAGCAGCGGTTGCAAGTGATCCTGAAAAGTACAACGAAGCATTTCTTG
GAAAACCAAATGAAGCGTATTGTGCTTGGATTATGGACCCTGAGAAGTGGGGAGGTGCCATAGAACTTTCAATTCTGTCAGAATATTATGGGCGTGAAAT
TGCTGCATATGACATCCAGACAACACGATGTGATCTGTATGGTCAGGGGAAGAACTACAATGAGAGGGCAATGCTCATTTATGATGGGTTGCATTACGAT
GCTTTAGCAATGTCTCCAGCTGAAGGGGCACCAGAAGAATTTGATCAGACCATCTACGTTGTTGACCAGAACCGTTCCATTGGTCCAGTAGAAGGCCTTG
CTCTTAACTTAGCGAAGGAGGCACATAGGAAGAGGAGCTACACAGACACCGCAAACTTTACATTGCGCTGCGGCGTGTGCCAAATTGGTGTCATTGGTCA
AAAGGAAGCTGTGGAACACGCGCAAGCCACCGGCCATGTCAATTTCCAAGAATACAAATGACCATAGAAGATATACTAGTTCTTCTTCTTCCGCTGTTGT
TGTACACTCATTTGTTGCAATTGTTTTCTTCCTGATATGGTACTATTGCAAAATATTAATTTGTTACAGAGCAAATTTAATAAGCTCCAGTTTGGATATT
page-top