Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34313  (registered. 2012)
Contig Information
Length 630 bp
Clones alternative view 225 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 8
Wh_f Spike at flowering date 5
Wh_h Spike at heading date 2
Wh_r Root 1
Wh_SH - 7
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 11
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 5
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 3
Wh_V4816 Shoot grown under cold condition for 16days 10
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 16
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 5
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 18
WH_XN Leaves, plant was grown at constant 23Ž 30
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 9
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 11
WH_XR Roots, 18 day old plants were grown hydroponically 9
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 13
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 13
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 8
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 4
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|32400768|gb|AAP80616.1|AF470355_1|AF470355_1 metallothionein [Triticum aestivum]
Score 211
Evalue 5.00E-53
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34313
TTTTTTTTTTTTTTAGACAGAAACTCCAAATTATTATTGTCTTATACATACATGTAGATGTAGATAAGACGGGGAAGGCACACCAGGACGGATCTCGAAC
ATAGGAAAAGGCGCATCACAACACAAGACGCCTTACACAGCACACGGTACAAGCCACAAGGGGCACACATACGCCATGAACTACTAGTGGCTCGATACGA
TGCGATAGATCTCATCTTATTCTCGGTGGCAATTAAAAACGAAACACACACCATGCATAACCACTAGTGCTCCTTCATCAGGTCCGTCCATGGCGTCTCC
TTGTCTTGATTTGATGGATCACTTGCAGGTGCACGGGTTGCAGGAGCAGTTGGGGCCGCACTTGCATCCTCCGTTCTCGGCGGCGGCCTCGAACGACGGG
GTGCCCTTGGAGGGCGCCACGCCCATGATGAGGGTCTGGGAGGTGGTGTTCACCCCCTCGTCCATCTCAGGGTACATCTTGCACCCTCCGCAGCCGTTGC
CGCACTTGCAGCCGGATCCGCATCCGCAGTTGCCTCCGCAGCACGACATGGTCGGTTGGTGATGATCTCCCTCTGAGTTTATCCGCTCTGCTCTGTGTCT
CTGGTCTGGTCTGATCTGATCTGCACCCGG
page-top