Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34294  (registered. 2012)
Contig Information
Length 1180 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242033687|ref|XP_002464238.1|| hypothetical protein SORBIDRAFT_01g014760 [Sorghum bicolor]
Score 469
Evalue 3.00E-130
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34294
TGGTAAGAGAATAGGCACCCAACTGGATGGTGCTTCAGTTGCAGACCTTCTTATACCAGCAACCAGTGCTGAAAATGGTGTGTATAATGTTGACCTGATC
ATGGCAATAGTAGAGCAGTTCATGTCACATCATAGTGATAATGGTAAAATGACTTTTCAAGATGATGATGAAATTGTGGAAGTCGAGAAGTTTGCTTCTG
TTTCCAGCACGTCAAAGCTGGCAGTTGCAAAGCTGGTCGATGAATATCTTGGTGAGATCGCTAAAGACCCTAACCTGCCTGTTCTGAAGTTCATTGCACT
TGCTGAAATGGTGTCTGCCTCGTCCCGACAAATGCATGACGAACTATACCATGCCATCGACATGTATCTAAAGGAGCACCCCAGCCTATCAAAGAGCGAA
AAGAAGAGATTATGTGGATTGATGGACTGCAAGAAGCTGTCCCAGGAGGCCTGCATGCACGCGGTGCAGAATGAACGGCTTCCTCTTCGTGTCGTTGTGC
AAGTTCTCTTCTTTGAGCAAGTCCGAGCATCAGCCGCTTCTGCCAGGAGTGACTCTGGAGCCGACCTTTCATCCGCTGTTCACTCGCTTCTTCCCAGAGA
GAACGGCAACTCATACGGCAGCTCAAGGTCAGCCGCCACAACAACAACCGAAGAGGAAGGCAGTGGAGTCCCGACATCCAGCGACATAAACTCTTTCAGG
TCGATGCGGCTCGCGAACAACTGCGGTGGCAGCGAGAGGAGCAGCACAAGCAGCGACATCAACAAGAACGGCGAAGACAAGAGCACCACCACCGGCAAGG
CGAAAGTGATGCTGATGCCGAAGATGCTAAGCAAGCTCTGGTCTGGGAAGACGCACGTTGGCGAGAACAGCAGCTCAGACGCGTCGGTGAGCCCCGGATC
CGCCAACCCGGAGGAGGTGAAGTCGACGCCGTCACGGAACACGAGGCAATCGACGTCCTAGTGGCTGGTGCTAACAGTATCATAGCACACGTAGTTTTTC
GCTGTCATTGCTTTGATTTTTTGCTTTACACGAGAGTAGCAATCTTAAAAAGTGGAGTACTACTGACTGCCCTGCCCTGTCGCCAATGATGTTTTTGAAG
CATTTTATGCTAGTAACTGGTGTAGCCCGTAGAGGTCTGGCCATTGGTGTTCAGGAACACATTTCAGGAGATAAAACTGT
page-top