Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34293  (registered. 2012)
Contig Information
Length 814 bp
Clones alternative view 85 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 16
Wh_VWD Shoot grown with dessication 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 14
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 15
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 11
WH_SP 3
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XV Leaves, plant was grown at constant 23 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|9624495|gb|AAF90200.1|AF287276_2|AF287276_2 chlorophyll a/b-binding protein precursor [Hordeum vulgare]
Score 387
Evalue 1.00E-105
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34293
TTTTTTTTTTTTGCTTCAAACTAGTAGTATGTTTTGCCATGTTTAGAATAACACGCATGGGTGATATTACAAGTCCAGCCTCCATCGGAAGCCATGGGCG
AATCCACAAGAAGAAAGTTTCACCACCGGAGCTTTTAAGATTACAACACATTTTTGCACTGTCCACCTACTCCTCCACACTTTGTACATCCTCAGCACCC
CAAAATAACAATTCAGACCACCTGAAGCCTCCCCGGTCGGTGAAATCGACGGATTTATTGGCCGGAGATGGTCTGGATGATGGTGTTGTGCCATGGGTCG
GCCAGGTGCTGCTGCAGGTTCTCGAACGGGCCCTTGCCGGTCACGTTGTGCTGCACCAGGAACCCCAGGAACGCCAGCATCGCCAGTCTCCCGTTGGCGA
GCTCCTTCTCCTTGTTCTCGAGGGTGGGGGCGAAGTTGAGGGGGTTGAAGACGCTGCCGGGATAGCCGCACTCGTGGGGCGGGAGGCTGTAGCTCTTGAA
GATGGGGTCCTGGTTGACGGAGCCCGGGTTCTTGATGTCCTGCCACCGCCGGATCTCCACGTAGTGGAAGAGGATGAACTCGATGACGAAGAGCGTGGAG
GAGGAGGCGAAGTAGGTCTCCTTGCCGGCGTCGTACCACTCGGGCGCGTTCAGCAGCCCCGCCTTGGTCAGCACCTCCGGGATCAGCATCCCCGCCACCC
CCAGCATCGCCCACCGCCCGTTCACCAGCTCCGCCTGCACGAACCACCGCAGGTCCTCCGGGTCCTCCGCCAGCGCCAGCGGGTCGAACCCATTGTCACC
CGCCAAGCTGCCGT
page-top