Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34292  (registered. 2012)
Contig Information
Length 829 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 5
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242055683|ref|XP_002456987.1|| hypothetical protein SORBIDRAFT_03g046830 [Sorghum bicolor]
Score 224
Evalue 7.00E-57
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34292
GCCGTCGCCCGCTCGCCCGCACCGAGCCCCTCGCAGTGGGCACCAACCCGCCGCTCACCGCCGGCCGTCGGGCTCCGGCGAGCGGCCGCGCCGCCTCGCC
GGGGAGCCGCGCTCCTGGTCAAAGCTAAGAAGGAAACATTTTCTACCTTCGACGAGTTATTGGAGAAGTCTGAAAAGCCTTTACTGGTCGACTTCTATGC
AACTTGGTGTGGTCCGTGCCAATACATGGTTCCCATACTTCAAGAAGTGCATGAGAAGATGAGTGACAAGATTAACATTGTGAAAATTGATACAGAGAAA
TATACAAGCATTGCAAATAAGTATAAAATTGAAGCATTACCAACTTTCATTATCTTCAAGGACGGGGAACCTTGTTATCGCTTTGAGGGAGCGTTGCCTG
CTGACCAGCTAATCCTGCAGATTGAGAGTGCTTTAGAAGCTCCAAAGTAGCATGTGCATGTATTGCCAGCAAGGAATTTCGCCCCCTGAAATGGCATGTG
TGAAGAATGTCCTCCTTATGGGTTGACCTGCCAACTATGTGAGATGGTCTGAAATCTCGGTGTACAAAGATATGGAAGCACACACACTTAGAAGCATCTT
TGTAGTATGTTTCTTTTGTGTAAATTCTTTCAGCGACTAAGATTTTGCCTCTGGTTTTCCATTTGCCTGGCACGGAAAATTACCATATCCATATTTACCA
AGTTGAAATGTTAAGTGCTGAAGTTTACTTCGAGGTAACGGTGGCATGGCATCTATATTTTCTTAGTCTGCTCCTTGAAAGACAACTTTATAATTTATCA
TCGCCTGTTGGCTTGGACCAAAAAAAAAA
page-top