Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34291  (registered. 2012)
Contig Information
Length 898 bp
Clones alternative view 126 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_yd Spikelet at late flowering 1
Wh_SH - 20
Wh_KMP Shoot grown under continuous light 4
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 6
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23 6
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 5
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XF Seedling, infected with leaf rust 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 9
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23 25
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 6
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 24
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|134290407|gb|ABO70330.1|| putative oxygen-evolving complex precursor [Triticum aestivum]
Score 384
Evalue 1.00E-104
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34291
CCGGGGAGGGATAAGAGAGAAACACAGGGCAAGAAGAGAAGAGAGAAGCAAAGCTTGAGATGGCGCAAACCATGGCGTCCATGACCGGCCTGTCGCAGGG
CGTGCGTCTCCCAGGCCCGACCGGCAGGCGCGCCAGCAGGTTCACCGTGAGGGCGTCGTCGGCGGAGGCGGAGGCCGCCGGCCGCCGCGCGGTCCTTGGT
CTCATGGCCAGCGGAGTCGTCGGCAGCGCGTTCGCTCAGGTGGTGCACGCCGGCACCGTCGCGGCCATCAAGGTTGGCCCACCGCCGCCGCTCTCCGGTG
GACTCCCCGGCACGGACAACTCCGACGAGGCAAGGGACTTCGACCTGCCCCTGAAGAACCGGTTCTACCTGCAGCCGCTGCCACCGGCGGAGGCGGCGGT
CCGGGCCAAGGAGTCGGCCCAGGACATCCTCAACCTCAAGCCGCTCATCGACAAGAAGCAATGGCCGTACGTCATGAACGACCTCCGCCTCAGGGCCTCC
TACCTACGCTATGACCTCAAGACCGTCATCTCCTCCAAGACCACCAAGGAGGAGAAGAAGGACCTCAAGGACCTCACCGGCAAGCTCTTCGCCACCCTCG
ACGGGCTTGACCATGCAGCCAAGATCAAGAGCCCCACCGAGGCCGAGAAGTACTACGGCGAGACCAAGACTGTTCTCGGCGATGTCCTCGCCAAGCTAGG
CTAGATGGATCCACATAATGGCCGTGCTGCTTTCAGGCCTTTTATGTTTGTTCATATTTGGAAGCCGGCAATGTAACTTCCCTGTTGATAATATGTCAAC
AAGCACTTAAGTATGATTCTATCTTGAGTCTTTCACAGATGAAATCACAAGCAGATTCAGTCATATGAAGAGTAAACATTAAGACAAAAAAAAAAAAA
page-top