Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34290  (registered. 2012)
Contig Information
Length 1259 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242093742|ref|XP_002437361.1|| hypothetical protein SORBIDRAFT_10g025580 [Sorghum bicolor]
Score 482
Evalue 4.00E-134
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34290
GCTCGTACCTACGGTACATGTCACAAAAGTTTAATTAATCCCCTTAAAACGTGCACTTAACCAATTCTGTGTATCTTATGAGTTCATTGAATCAGTGACA
GCAGCAGCAACATCGTTTTTTTTATCCTGTTCATTCGCTGGATCAGTCGCAGCAGGAGCAACATCGTCTTTATCCTTCTCATTCGCTGGATCAGTGACAA
CAGCAACAACATCATCTTCTTTATCCTTTTCATTCGCTGGACCAGTGGCAGCAGCAACATCATTTTCCTTGTCCTTTTCATTCTTCTTCACCTTCACGGG
AAAATCTTCCTCCTGCTGCCGGTGCCACCGGAAATTTGAGGCTTCAATCCAGCGGGGGTGGACCAGGATCTTGTTGTTCTTAACTGCCCAACGGGCCTTA
TCAGTTCCAACATCCACAGCGACAACATGGGTGATAGTGGAATCCACGTCCGCGGAACAAATGGCTCCCAGCTGCTCGGCCATCTTCCAGATAAACTGAT
CCTGTGGGCGAGAACTGGACGGGAACACCCGACTGAAGACTAATTTGCAGCCTTGCAGTACTTCTTGCCGTACCCTCTTGATTACCTGTCTTACATCCCG
TGAAGAAAGAGCAGTTTCAACAGCCTACAGAAGTGCAGGACAATTGATTAGGTAAAAACATCAGTGCTTACTAGAGTCAAGTTTATGCACAGCAGCAGAA
AGGCAGCAGGACAATAATTTGTGGTAAAAACATGTACTTAAGTAAACAACCGAGTCAAAGAAAATCGTGTGTATACGCTTCAGAACATCTAAGATAGTGG
CCAAAGCACCATCACTCCCCCTTTCATCTTGCATCAACTCTGACAGAGATTTGACGCTAAAACCAAACTGGCGACAGCTCGAAGCAAAGTAATGATATCT
CTCCATCAGTATTAGGTTTTCTTTATGCTTCTGCCAGACATACTCAGTATCATCAAGAATCACGGCAACACTTTCAGCTCCAAGAACCATATCAAGACCT
TTCTGGTGTCGCTGTGTGCAGTCAGAGTTTGAAATCACTTTGGAATTAAAATAGACATTACGAGGGTCAAGAAGCTTTGCTATTTCAATTGCATAAGCCT
TGTCGCCCATGGTGTATATATACATCTCAAACATATTGCTTGCTTCTTTTAGAAATTTACGGACAAAGGGTCTCAACTTTGTAAGCATCTGCATTCCTTC
TAATGTGAACAAGCTTCCATTTGGATCGTCTTTTGATGCAGCAGTCTGAATTCCCAGGT
page-top