Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34288  (registered. 2012)
Contig Information
Length 804 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|60100238|gb|AAX13288.1|| senescence-associated protein [Triticum aestivum]
Score 273
Evalue 4.00E-80
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34288
CTGCATCGTAGCTAGTATATATATTGGCTTGANCTCATCGTCCCAAGAAGGAACAGGAGCGAGGACCGGACTGGAGATAATGGCATCCGAGTTCTCCCTT
GCCCGAGGCGTCTCCCTCCCCGCCGCCGCGCACTGGCCGCCCCTCGCCTTCACCTCCTACAGGCTGCGGCGAGGGCGGTCTCAGTGGCCGCCGCCAGGAG
GATGCCCGGCTCAGTCAGATACGGCGGCGCCAGGGTAGCGGCGTTGCGGGCGGAGGAGGCCGAGGTGGCCGTGCCACCGTCGGTGTCGGTGCGCGTCGCC
TACGAGCTGCAGCTGGCCGGTCACCGCTACCTCGATGTCAGAACGGAGGGCGAGTTCGGTGGTGGGCATCCGGCAGGAGCGGTGAACGTCCCCTACATGT
ATAGCACCGGCTCAGGAATGGCCAAGAACCCGCACTTTCTCGAGCAAGTGTCGGCGATCTTCGGCAGGGACGACGAGATCATCATCGGATGCCAAAGTGG
CAAGAGATCTCTCATGGCGGCAGCCGAACTCTGCTCCTCTGGCTTCACTGCCGTGACCGACATCGCCGGAGGGTTCTCGACTTGGAGGGAGAACGGACTG
CCGGTCAATGGACGCGGGCTTCTATAAATGTGGTTGAAACATCATAATTTGTCTTAGCATGCTCCGAGACACCACATCAGTGCACTGAATAAGCAAAATG
GAGTTTGATATGATCTACTCCTCCGTACCAGAATACTTGTAGCTGGGGAAGCTAATACAAGTTCCCCCAACTACAAGTATTTCGGTATAGAGGTAGTATA
GGAT
page-top