Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34285  (registered. 2012)
Contig Information
Length 894 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|219887917|gb|ACL54333.1|| unknown [Zea mays]
Score 453
Evalue 1.00E-125
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34285
TCCTCCTCCTCCCGGGCGGCCATGGCGGCATGTACGCCAGCGACGGCCGCCGTGTCCTTCTCTCTTCCGTCGTACCCGCGCCGCCTCCGGCGCCGCCCGT
CCCTCCTCCGCGCTGCGTCCACTGCGGCGCCCCCGTCCCCCGACCTCTCCATCCAGCTCTCTCCCCGCCCTTCCCCGCGCACCTCGCCTCCCGTAGTACC
ATCCCTCGCCCGCGACCGCGCAGAGGACCTGCAGGCCGAGTCCCGCGCCATGACCCGAGCCGCTGCCGCCACCGTCTACACCCCCGAGCTACTCGCCTCC
CGCTACGGCTCCCAACCTTTCCAGGTGGCGATGAGAGCGGCGGAGGTGCTCTCGAAGCTGGGGGCATTCGGGCTAAAGCTGCTGCTCGACCAGCAGAGGG
GGGAGTCGTCCTCGTCAGCGAAGAGGCGTGCCAGGGCGGTCGAGCTGCGAACTGTACTGACAAGGCTTGGCCCGACGTTCGTCAAGATTGGGCAGGGTTT
GTCCACGCGGCCTGACCTCTGCCCGACTGAGTATCTCGAGGAGCTCTCCGAGCTGCAGGATTCTCTCCCCACATTTCCAGATGAAGAGGCATTTGCCTGT
ATCGAGAGGGAGCTTGGCTTTCCTCTTGATTCAATGTACTCAGCAATGTCACCTTCACCGATAGCTGCAGCAAGTTTAGGTCAAGTTTACAAGGCACGGT
TGAAATACTCTGAGCAGTTGGTAGCTGTCAAGGTGCAAAGACCTGGCATCGAGGATGCCATAGGCCGTGATTTTTACCTACTGAGGGGACTTGGTTTTCT
AATAAATAAGTATGTTGACATTATAACTACTGATGCAGTTGCTCTGATAGATGAATTTGCCCGAAGAGTTTTCCAAGAGCTTAATTATGTCCAG
page-top