Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34284  (registered. 2012)
Contig Information
Length 726 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_V483 Shoot grown under cold condition for 3days 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115455569|ref|NP_001051385.1|| Os03g0766900 [Oryza sativa (japonica cultivar-group)]
Score 394
Evalue 7.00E-108
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34284
CCCTCGGACCCGACCGCGGCAGCCGCCGATCCAGCCCCCGCCGCGATGGAATTCGCCCTCGTCGACGGCGAGAAGTTCTCGCCCTCCTGCTCCACGCTTG
TCATGCCCGCGCTTTCGATCGGCAACGTGGGGCAGCTCGCCGTGGACCTGCTGATACCTTCGGCGAAGGCGAGGCGCGTGGCGTACCTCGACGAGCCCTC
CGTGCTGCCCTGCATCGGCAACGACGCCTTCGGACCGGACGCCGTCGGCGACCTCGCGCTCGCGCTCGAAGAATACGAATCACCGTCTCACGGGCTGGCT
TTCATTCAACAAAGATCTCCAGTTATTACGGGGATGATGGTTTCGTTTGCCAAAAATGTTGCTAATTTCATCAGTAGCATTGGGAAGGACCATGTTGTTA
TTCTTTCAAGTTTAGATTCTGGCAAGAGAAGAGTAATTGATGCATCCAGTGATATGCTGTATTACCTTTCAAGCTGCAATGAGGATGGTTCTGATCCAGA
ATGTGAGAAACTAGGGTGGAAGAAACTTGAGGAATATGATCCATCTCAACGACTGTGGAAATGTCTTGCTAGTCTAATTGAGGGTGGTGTTCTTTCAGAA
GATATGGCTGATGATCCTGAAGAGATGACCGCAAGTGATTACTACGCGACCTTGCCATTTGCAGCTCTATTCTTTGCCTGCNNNNNCAAAGGTTTGAAAG
TTAGCTGTGTATTATGTTACTGTTCA
page-top