Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34283  (registered. 2012)
Contig Information
Length 602 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|109238643|emb|CAG38125.1|| cystatin Hv-CPI9 [Hordeum vulgare subsp. vulgare]
Score 246
Evalue 9.00E-64
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34283
CCCCAACACACAGAACTACAAAAATGGCTACCTCCACCGCCGCCGCCATCCCCTGTCTCCTCCTCCTCGCCACGCTCACCATCGCCGCTGCTGAAATAGG
GCACCCGCAGGCTCCGGCGGCAGCCGCAGGCGCTGTGGGCGGCCGGACGGAGATCAGGGACGTGGGCAAGAACAAGCTGGTGCAGTCCCTGGGCCGGTTC
GCGGTGGCCGAGCACAACCGCCGCCTCAGCCACGGCGGCGGACCAGCCAACAACGGCGACCCCGTCCGGGTCCAGCTTGTGTTCACCGCCGTGGCGGCGG
CGCAGAAGCAGGTCGCCTCCGGGGTGGTTTACTACCTGAAGGTTATCGCCCGGGACCGCGCCGGCGGCGGCGGGGACAGGCCGTTCGACGCCGTGGTGGT
CGTCAAGGCGTGGATCAAGTCCAAGGAGCTCGTGTCTCTCATGCCTTCTCCCAAATAATCGACAGGCTGGCTGTCAGGTGTACGTATGTGCGCTCCGTGC
TGGTGTTGTGCTGTCCTTGTTACTCGTTGCATTTTTCTCGTCACTTGAGTATGTACTAGTGCAACTAAAATAAAAAGCGTGGTTACAGCATGAAAAAAAA
AA
page-top