Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34281  (registered. 2012)
Contig Information
Length 887 bp
Clones alternative view 23 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 1
Wh_VWD Shoot grown with dessication 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|12958607|gb|AAK09372.1|AF321557_1|AF321557_1 sucrose-6F-phosphate phosphohydrolase SPP2 [Triticum aestivum]
Score 439
Evalue 2.00E-121
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34281
AACAAGTAGCACATCGAACTACTAGTATATACTGGACTGGGACTGGTGTTATTTACTTTAGTTTAGCCTCTCATGACAGTAACGACGAGATACAAGCATT
AGGCAAAGGCATCAAGAGACGTCATCCAGTCCAGTATGTGTGTCTGGGAGCACTTATTAACAACATTATGAACAAGTGAAAGAAATTCCCATGCTTTCGG
TACACGATTTCTTATTTGATCCTCAAGAGGAAAATGCGCCGGCGGTAGCTATCCAGTCTAGAGTTTGCATGACTGCTCGACCCCGGGATATTCTTTACGC
CATGTCTTGTGGATGTGTGTTACCACAAAACCCCCAGGGGTTTCAGGCTTTACATTCAGCGCAAGAGTTGTAAAACAGCACGCCCACGCAGCACCTTCTG
CCTCCCACAAGTCGAATCTCACAAGCCAACTGTCAGAAGCAGTCTGCAAGATAACTAGTCTGTCCACCCATGACCGGTACTTTTTCCCTTGTTTGTCACC
ATAACATGAAGCGAGCTCATCAATGGCCGAATGGATCGAAAGTTCGACCCCAGACGGATGAATAATAACTCCATTTGCATCTGTGATGTTTTTGAAGTAC
TGTATAACTGAATCAGCCTTTGGAACATCAGCTCTACGCCACTTTTCGTACAGAACATAGAACTTCACAATGGCCGCTGTAGGCTTGAAAGGGTCCTCCT
TGATGTAAGGAAACTCAACGTCTCTTGGAGAAACATTAGGTCCTAGCTTGAAGTGCCCAATAGCTTGAATAATACCAGCAGCACACCTCTCAGTTGCATG
AATTATCTTAGGATTATCCTTCGCATTTTCTGCATGCCACTGGAGTAGTTCCTCTTGGGCATTGCTAACCATGACACCATGTACACC
page-top