Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34280  (registered. 2012)
Contig Information
Length 671 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|132087|sp|P00871.2|RBS1_WHEAT|RBS1_WHEAT RecName: Full=Ribulose bisphosphate carboxylase small chain PWS4.3,"
Score 356
Evalue 1.00E-96
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34280
AGACCTTCATACATAGGCCATTGTTTCAACTNNNAGTTTAGGCCTTGCCAGACTCCTCGCAACCCGGTGGCCTGAATGCGATGAAGCTGACGCACTGCAC
CTGGCGCAGGTTGTCGAAGCCGATGACGCGGACATAGGCGTCAGGGTACTCCTTCTTGACCTCCTCCACCTCGTTGAGCACCTGCGTGGCGTCGGTGCAC
CCGAACATAGGCAGCTTCCACATTGTCCAGTATCGGCCGTCGTAGTACCCGGGGGAGCTGTTGTGCTCACGAAAGACGAAGCCAACCTTGCTGAACTCGA
GGCAGGGCACCCACTTGGAGCGGATCAGGTAGTCGACCTGCTTCAGGAGGGCCTCCGTGGAGAGGGGTGGCAAGTAAGACAGGGTCTCGAACTTCTTGAT
GCCCTCAATCGGCCACACCTGCATGCACCTGATCCTTCCGCCATTGCTGACGCTGCCGAGGCTGCCGCTGGAGCGGCGGCTGACGGGCAGACCGGCCGTG
GACTTGAGCCCCTGGAAGGGTGCGACGGTGGTAGCCGACGAAGCCATCACGGCGGGGGCCATGGTATTGGCACTAAAGGGGCCTACGGTCGATTACACTC
ATTCGTCGTCGTCCTCATCGACATCAGCACCAGCAGATGAGTTGAGGGCGTTGAGCCGCTCCACGAGACTG
page-top