Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34279  (registered. 2012)
Contig Information
Length 721 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_SP 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|498742|emb|CAA84023.1|| beta-ketoacyl-ACP synthase [Hordeum vulgare subsp. vulgare]
Score 308
Evalue 4.00E-82
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34279
ATAGGATGTACCAAAGTGCATGTGCAACGTCTTGATTAACTTCTGAATGGACACCCTTGCATGGGATATAGTATTTGCTTTTGCAATACAAAAGAAACTT
AATTGCTTTCTTTGCTCACCTATGTAGCAATATATTCTACTGAGTTGGATTCCCATTACAAATTTGTGGCTCATGAAATGTTGCTGTCTTGCCGAGCTTT
GTCAAAATTCCAGTTCCACGACACAATTGTGTCATAAGCTAGCACACCAAACGAGCTCAAAAGGGCGCAAATAAAATTGATGAATTGTGCCCACCGAATC
CAAATGAATTCGACAATGCGACTTTCACATCACATCTCTCCTTTTGTGATCCCACCAGCAAGCTGACATCCACATTTTTCTCCGGATTGTCTAGATTGAT
ATTCGGATGGATCCAACCGGTTCTTATAGCTTGTATAGCAGCTACAGCTTCTATTCCACCTGCAGCACCTAGCAAGTGGCCAGTCATCGACTTTGTTGAG
TTTACTCTTAGCTGAGGATTCTGCCCAAAACAGCGGCAAAGAGCTTCGAATTCCTTTAAATCACCCAACTGTGTAGATGTAGCATGGGCATTTACGTAGT
TAATGTCTTGCCTTGTTACTCCTGCATCAGCTAGTGCATTTTTGACACAAAGAATAACCCCCTTCCCTTCAGGATGTGGTTCCGTCATATGATATGCATC
ACACGTAAAGCTTCCACCCAG
page-top