Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34278  (registered. 2012)
Contig Information
Length 1212 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
Wh_yd Spikelet at late flowering 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|152126071|sp|A2Z3C4.2|6PGL4_ORYSI|6PGL4_ORYSI RecName: Full=Probable 6-phosphogluconolactonase 4, chloroplastic;"
Score 473
Evalue 2.00E-131
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34278
CCCTCCTCGCCCGCCGCCGCTCGCCGCCGGCGTCCCTCGTCCCGGTCCGGAGCCTCCGGTCCTGCCCCCGTCCCCGCCTCCTCTCCTCCGCGCGCACGAC
CCCCGTCCTCCTCCCCGCCGCCGCGATGGCCGCCCCGGCCCCCGCCGCCTCCTCGAAGAGGGACCTGCTCATCTTCGACGCCGAGGAGAACCTCGCGGTG
GCCCTGGCCAAGTACACAGCGGATATTTCCGCGAAGTTCGCCGCCGAGAGGGGCGCCGTCACCGTCGTGCTCTCCGGCGGATCCCTCATCTACGCCCTCA
GGAAGCTGACGGAGGCGCCGTACCTGGAGACGGTTGACTGGAGCAAGTGGCATGTGTTCTGGGTAGACGAGAGGGTCGTGCCCAAGGACCACGAGGATAG
CAACTACAAGCTCGCCCTGGATGGGTTCCTCTCCAAGGTACCAATTCCTGCTGGTCAAGTGTATGCTATCAATGATGCCTTGTCTGCTGAGGGAGCAGCA
GAGGACTATGAAACTATCTTGAAGCAACTTGTTAAGAATGGCGTCCTTGCAATGTCAAAGACAACTGGGTTTCCCAGGTTTGATCTCCAGCTTCTTGGCA
TGGGCCCTGACGGTCACATCGCCTCTCTCTTCCCAGGCCATCCTCTTGTTAAAGAGAACAAGAAGTGGGTCACCCACATCTTGGACTCTCCAAAGCCGCC
ACCACAGAGAATCACATTCACGTTTCCGGTGATCAACTCGTCCGCATATGTCGCCATGGTGGTAACTGGGGCTGGGAAAGCCGGTGCAGTGCAGAAGGCG
ATTTCGGACAAGAAGACATCTGATTTGCTCCCTGTTGAGATGGCTATACTTGATGATGGAGAATTCACCTGGTTCACCGACAAGGAGGCGGTGTCGATGC
TGCAGAACTAGTGGGTCCCATGGCGGTCTAAGGGTTTAAGCTCGTACTTAAAATAAAAGTGAATCCCACGGTTGCATTCCTCCCTGGTGGGTCACCTGTA
AGGTGAACTTGAGCTTTATGTACGTACTGTAGTATACTGTTTCAGAGTAATGTGTTTCAGACACCCCCTCGGCTTCCAGCGTTTAGTAAATAACATTTGG
TGAGGCATTGCGCCCAACGGGTGCTCGGATTATTTACCAAACTTGTGCTTTTAAATGTTATGGCCCCGTGACTATGAAATGCCATGCCTGTTGCATCCTG
TTACTGTCATGT
page-top