Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34277  (registered. 2012)
Contig Information
Length 1147 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242043820|ref|XP_002459781.1|| hypothetical protein SORBIDRAFT_02g010510 [Sorghum bicolor]
Score 543
Evalue 1.00E-152
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig34277
GGAACTACATGCACAAGGTTCTACATGTACATGGTTTTCCTTTTCACAATACAAAATACAATAGATTAGAGTGGTTGATTCAGGATCCAACGGCTGAACA
TGGCGAAGCACTTCTCAGGCTCATACTCAGGGGCCGTGTGACCGGCTCCCTTTACGGTCGCGAATGTCATGTTGTTGGTGTAACTTACGGTGAATCCGGC
AGACTGGCCATGGAGATGCCACGCCCTCCACTCGTCAACGATCGGGAAGCCGAGCGATCTCACCCACGCCTGCGTCCCCAGGTGTGGCACCACCGAATCG
TGGTCGCCGCTGTATACAAGCGCACGGTAGCCGTTGGCCGTGACGTTCCGGTGATACTTGATGGTACTCACGATGTCCCTGGTGTAGGGGACACCGCCAT
CTTGGCACCTCACCCACTCGTCCACGGTGCCCTCCTTGACGCCGAGGGCGTCCCGGGTGCGCTCGTCGTTCGCCCAGAAATACGACAGGTAGTGGGCGTA
GTTAATACAGTCAAGCGGAGGACGAACTGGCGGATGTTTCAGCCGTTTCCCCATTTTGATTCCAGCTGCTTCCTCGCTTAAGATCTTCCTGCCAGCACCA
GCCGAGTCGTCCGTCTCCGCGTGCGGTCCAGCAGATGAATAAACGCATTTGTCCCACAAAATATGGGGCAACATAACTTCGGAGAGGAGACTATGGAAAG
TACCCAGAGCTTTAGCACACAGCACGTTTGTAGGATTCTTGTAGTCTTGCCCTTGACAATGACCCAATATTGTCTCATATAATTGATCTGATATTATACC
AAATCCGTGGGCAAAAGGCACTTTGGAGCTTTCGTCGATCCTTTCACCTGTTGCCGGGTTACCTAATAGATAGCCCTTGAGATTAAGAAGGGGTCTCCTT
CCAACTTCATTACCTTGGGAAATCTTTTGTGCGATGAATGGTACAATTTTTCCAGCATACGAGTCTCCCCCGATGTAGAGAGGACTTGATAAAAACTTGG
GATGGTCCCTAATCCACTTGATGAGGAAATCATGTAGCTGCAGTGAGGTAGATACTTCCCCAACATGGTAGCCTTTGGGTTGTTTGGAAAAGGAAAATCC
TGCCCCGGCCGGCGAATCAACGAAGAGGATATGCGCCACCTTGGTCC
page-top