Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig34271  (registered. 2012)
Contig Information
Length 777 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig34271
CCAGAAGTAAAACGAAGAAGAGTCGTCGTGCTCGTGCGTGCGTGCAGATCAGCCACGCCTTTGCATCCGAGAGGAGTGACAAGGGGGAGCATACATATAT
GGCGGCGGCCATGGAGCAGAGCAACGGGGGCGGCGGCGTGAAGGTCAAGTTCATCGAGACGCAGTTCGTCAGCTCCGACGCCGCCAACTTCAAGTCCGTC
GTGCAGCGGCTCACCGGCAAGTACTCCAAGATGCCGCCGCCGGCGTCCTCGGTACACAGGCCTCGCCCAAGGCCCTGCGGCAGACCCGACCAACAAGGGC
GGCCTTGCGTCTCCGGCAGCGACGAGCTGATGATGGCTGCGCCGGCGAAGCCAGCGGCGGCAGCTTTCGAGCCGCTGCGCGTGGAGGAGGTGAACGAGCT
CTGCGACTTCGCCGATCTGCTCTACGCCGCCCCAAGCGCGCGGCGCCACGGCGGGAGCGTCGTAAATGGCTTTCCTTACTGATACATGCGTGGCCCGAAG
AAGAATCGTGTTACCCTTCTCATTGAGGATCATGTATTTGTTTGAGGATTGACATTGCAGTACTGGCAGATGTGATCCTTTTGCTCAAATGCTCACTGGG
AGCGCCAGATGTGATCTTCCTCAAACACAAGTGGAAGTAAGAGGAAAATACGAAAATGTATGAATATATTGTGTTGAGCGAAAAGGGAAAAGAAAGAGAT
GGATATGTATGCTGGTAAACTATGGTGTGTCGTCTTCTTGTCGGGTTACATGGGCAACTGTAAGGCTTCATTTGGAT
page-top